ID: 1085391676

View in Genome Browser
Species Human (GRCh38)
Location 11:76185358-76185380
Sequence CTTCCGTGTCACCTCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085391676_1085391679 4 Left 1085391676 11:76185358-76185380 CCATGAGGGAGGTGACACGGAAG No data
Right 1085391679 11:76185385-76185407 GAGGGACAGTGATGTGCCTGCGG No data
1085391676_1085391681 22 Left 1085391676 11:76185358-76185380 CCATGAGGGAGGTGACACGGAAG No data
Right 1085391681 11:76185403-76185425 TGCGGTGATCCTGTTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085391676 Original CRISPR CTTCCGTGTCACCTCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr