ID: 1085394639

View in Genome Browser
Species Human (GRCh38)
Location 11:76201112-76201134
Sequence CACCTTCTCCCTGAGCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 8, 3: 43, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085394639_1085394646 28 Left 1085394639 11:76201112-76201134 CCAGAAGGCTCAGGGAGAAGGTG 0: 1
1: 0
2: 8
3: 43
4: 335
Right 1085394646 11:76201163-76201185 AGACTCCCCAGGCGGCCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1085394639_1085394640 2 Left 1085394639 11:76201112-76201134 CCAGAAGGCTCAGGGAGAAGGTG 0: 1
1: 0
2: 8
3: 43
4: 335
Right 1085394640 11:76201137-76201159 GTCAGAGCACCTTCCAGACGAGG 0: 1
1: 0
2: 0
3: 9
4: 84
1085394639_1085394644 20 Left 1085394639 11:76201112-76201134 CCAGAAGGCTCAGGGAGAAGGTG 0: 1
1: 0
2: 8
3: 43
4: 335
Right 1085394644 11:76201155-76201177 CGAGGCTCAGACTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 15
4: 207
1085394639_1085394645 27 Left 1085394639 11:76201112-76201134 CCAGAAGGCTCAGGGAGAAGGTG 0: 1
1: 0
2: 8
3: 43
4: 335
Right 1085394645 11:76201162-76201184 CAGACTCCCCAGGCGGCCCAAGG 0: 1
1: 0
2: 0
3: 28
4: 286
1085394639_1085394643 17 Left 1085394639 11:76201112-76201134 CCAGAAGGCTCAGGGAGAAGGTG 0: 1
1: 0
2: 8
3: 43
4: 335
Right 1085394643 11:76201152-76201174 AGACGAGGCTCAGACTCCCCAGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085394639 Original CRISPR CACCTTCTCCCTGAGCCTTC TGG (reversed) Intronic
901065628 1:6492910-6492932 CCCCTTCTCCCTGTGCCCCCTGG + Intronic
901290550 1:8120793-8120815 AACCTTCTCCATGTGCCTCCAGG - Intergenic
902608322 1:17581851-17581873 CTCCTCCTCCCTGAGCCTCGGGG + Intronic
902805493 1:18858999-18859021 CACCTCCTCCCTGAGCCCCTTGG - Intronic
903165847 1:21519898-21519920 CACCTGTTCCCTAGGCCTTCTGG + Intronic
905563436 1:38944929-38944951 CATCTTCTCCTTGTCCCTTCAGG - Intergenic
906513396 1:46424128-46424150 CACCTGCTCCCTGTGTCTGCGGG - Intergenic
906808993 1:48807417-48807439 CACAATCTCCCTGAGCCTTGTGG - Intronic
909765623 1:79352603-79352625 CACCTACTTCTTGAGACTTCAGG - Intergenic
910444918 1:87290491-87290513 CCCCTTCTCCCTGTCCCTGCTGG - Intergenic
913066175 1:115257481-115257503 CATCTTCTCCCTGTGTCTTCAGG + Intergenic
913574158 1:120153218-120153240 TACCTTCCTCCTGAGCCATCTGG + Exonic
914295428 1:146318021-146318043 TACCTTCCTCCTGAGCCATCTGG + Intergenic
914556468 1:148768802-148768824 TACCTTCCTCCTGAGCCATCTGG + Intergenic
914616366 1:149361428-149361450 TACCTTCCTCCTGAGCCATCTGG - Intergenic
914850485 1:151310267-151310289 CTCCTTCTCCCTTTGCCCTCTGG - Intronic
914877856 1:151525596-151525618 CCTCTTCCCTCTGAGCCTTCTGG + Intronic
914912100 1:151795915-151795937 CACCTGCTCACTGAACCCTCTGG - Intergenic
915030788 1:152878998-152879020 CACCTTCTCCCTCTGCCCACAGG - Intronic
918126313 1:181587258-181587280 CACTTACTCCCTCAGTCTTCTGG - Intronic
918534290 1:185557364-185557386 CTCATTCTCCATGAGCCTTAGGG - Intergenic
918729683 1:187976044-187976066 CACCTCCTCCCTGACCATTTGGG + Intergenic
919857893 1:201718235-201718257 CACCTCCTCCATGAGGCCTCTGG - Intronic
921176890 1:212603220-212603242 GTGCTTCTCCCTGTGCCTTCAGG - Intronic
921260821 1:213383785-213383807 CACCTTCTCACTGTGTCCTCAGG - Intergenic
921543861 1:216450979-216451001 CACCTTGCCCCTGAGCTTTTGGG + Intergenic
922810201 1:228411036-228411058 CACGCTCTCCCGGAGCCTGCTGG + Exonic
922929507 1:229377661-229377683 CACCAACTCGCTGCGCCTTCAGG + Intergenic
923132805 1:231092094-231092116 CACCTTCTCCGTGTGCTTTGAGG - Intergenic
923351832 1:233114940-233114962 CACCTTCTACCAGAGCCGTGAGG - Intronic
923480330 1:234377641-234377663 CAGCTTCACTCTGATCCTTCTGG + Intronic
924102177 1:240616219-240616241 CACCTGCTCCCTGGGTCTTAAGG - Intergenic
924740615 1:246792566-246792588 CACCTTCTTCATGAGCATTCTGG + Intergenic
924741395 1:246796122-246796144 CACCCTCTGTCTGAGCCTTTGGG + Intergenic
1063391182 10:5650770-5650792 CACCTGCTCCCTGAGCCTGCAGG + Intronic
1063701445 10:8388656-8388678 AACCCTTTCCCTGTGCCTTCTGG - Intergenic
1063807106 10:9658213-9658235 CCCCTTGTGCCTGAGACTTCCGG - Intergenic
1064435137 10:15304607-15304629 CTCCTGCTCCCTCAGCCTCCTGG + Intronic
1064543127 10:16425245-16425267 CTGCTTCTCTCTGAGACTTCAGG + Intergenic
1065178696 10:23103974-23103996 CATTTTGTGCCTGAGCCTTCTGG + Intronic
1066217014 10:33297783-33297805 CTCCTTCTCCCTCTGCCGTCAGG - Intronic
1067554955 10:47262408-47262430 CGCCTTCTCACTGGGTCTTCAGG - Intergenic
1068633604 10:59323743-59323765 CCACTTCCCCCTGAGCCTTAAGG + Intronic
1069773115 10:70911751-70911773 CATCTTCTCCCAGAGCCTCCTGG + Intergenic
1070290785 10:75111918-75111940 CCACTTATCCCTCAGCCTTCAGG - Intronic
1072621424 10:97081898-97081920 CACCTTCAACCTGACCCATCTGG + Intronic
1073195013 10:101683389-101683411 CCCCTTCTCTCTCAGCTTTCCGG + Intronic
1073540118 10:104311149-104311171 CACCCTCTCTCTGAGGCTTACGG + Exonic
1075089378 10:119434882-119434904 AAACTTCTACCTGAGCATTCAGG + Intronic
1075349200 10:121708843-121708865 CCGCTTCTCACTGTGCCTTCTGG - Intergenic
1075561844 10:123473896-123473918 CTCCCTCACCCTGACCCTTCAGG + Intergenic
1076679734 10:132165551-132165573 CACCTTCTGCCTCATCCTTCCGG + Intronic
1077555289 11:3223030-3223052 CACCTTCCCCTGGAGCCCTCAGG + Intergenic
1077962267 11:7088807-7088829 CGGCTTTTCCCTGAGCTTTCAGG + Intergenic
1080051362 11:27862339-27862361 TCCCTTCTCCCTGAACCATCAGG - Intergenic
1081700997 11:45152798-45152820 CACCTGATTCCTGAGCCCTCCGG + Intronic
1082005846 11:47418592-47418614 CAGCTGCTGCCTGGGCCTTCAGG - Intergenic
1082763737 11:57150093-57150115 CACCTTGTCCTTGTGCCTCCAGG - Intergenic
1083401836 11:62428857-62428879 AACAGTCTCCCTGAGCATTCGGG + Intergenic
1083634843 11:64115015-64115037 CACCTGCTCACTGAGCCAGCAGG - Intronic
1083841668 11:65308430-65308452 CACTTCCTCCCAGAGCCCTCTGG - Intergenic
1083922850 11:65789806-65789828 AACCTTCTCCCAAAACCTTCTGG - Intronic
1084040949 11:66542470-66542492 CACCTGCTCCATGAGCCTGCAGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084579763 11:70015810-70015832 CACCCTCTCCCAGGCCCTTCTGG - Intergenic
1084600514 11:70142804-70142826 CACCTTCTCCCTGTGTCCTCAGG + Intronic
1085083503 11:73651946-73651968 CCCCTTCTCATTGGGCCTTCTGG + Intronic
1085191892 11:74633552-74633574 CACCTGCTCCCTGAATCTCCTGG - Intronic
1085394639 11:76201112-76201134 CACCTTCTCCCTGAGCCTTCTGG - Intronic
1085531356 11:77194122-77194144 CACCTTCTCCTGGATCCCTCTGG - Intronic
1085638669 11:78177520-78177542 CACCTCCTGCCTGGGCCCTCTGG - Intronic
1085751659 11:79167639-79167661 CCCCTTCACCTGGAGCCTTCTGG - Intronic
1085841076 11:80012583-80012605 CACCTTCTCCCTCAGCAATCTGG - Intergenic
1086574853 11:88328463-88328485 CATTTTTTCACTGAGCCTTCTGG - Intronic
1087438803 11:98157096-98157118 CATCTTATCCCTGATCTTTCTGG + Intergenic
1088407880 11:109500704-109500726 CCCATTCTCCCTAAGCCTTTGGG + Intergenic
1089235711 11:117023254-117023276 CAACTTCTCCCTGTGCTTTGGGG - Intronic
1089556467 11:119318142-119318164 CGGCTTCTCCCTGGGTCTTCTGG + Intronic
1089623958 11:119739643-119739665 CCTCTTCTGCTTGAGCCTTCAGG + Intergenic
1089892568 11:121896098-121896120 AACATTTTCCCTGAGTCTTCTGG + Intergenic
1090256708 11:125289569-125289591 CACTCTCTCCCTGAGCTTTCAGG + Intronic
1090437351 11:126697726-126697748 CAGCTTCTCCCGGGGCCTCCGGG + Intronic
1091071589 11:132569289-132569311 CATCTTCTCCCTGCGCCTCATGG - Intronic
1091900595 12:4141112-4141134 GACCTTTTCCCTGGGCCTCCAGG - Intergenic
1092024283 12:5227904-5227926 CACCCTCTGCCACAGCCTTCCGG + Intergenic
1092127481 12:6085097-6085119 CACCTTCTCCTTGGGGCTCCTGG + Intronic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1094566658 12:31604813-31604835 CACCTTCTCACTGTGTCCTCAGG + Intergenic
1096465929 12:51847879-51847901 CACCTTCACCCTGGGGCTACAGG - Intergenic
1099286759 12:80722466-80722488 TAACTTCTGCCTGAGCCTCCTGG - Intergenic
1100354317 12:93814692-93814714 CACCAACTCTCTGAGCCTCCAGG + Intronic
1100405864 12:94272525-94272547 CACCATCTCCCAGTGCCTCCTGG + Intronic
1100548377 12:95624301-95624323 CACCTCCTCCCTGCACCTGCAGG + Intergenic
1101071492 12:101080592-101080614 CATCTTCTCCCTGTGTCTTCAGG + Intronic
1101848150 12:108380200-108380222 CACCTACTCTCTGAGCCTCAAGG - Intergenic
1102569954 12:113821382-113821404 CTCCTTCTGGCTGAACCTTCTGG - Intronic
1104733327 12:131121088-131121110 CACCGCCTTCCTGAGCATTCCGG - Intronic
1105426921 13:20302093-20302115 CACCCTTCCCCTGAGCCCTCCGG + Intergenic
1105673391 13:22644290-22644312 CACATTCCCCCTGGGGCTTCCGG - Intergenic
1106172050 13:27296703-27296725 CTCCTGCTCCCTGAGCAATCTGG + Intergenic
1108643571 13:52405903-52405925 CACCGTCCACCTGCGCCTTCAGG + Intronic
1111277304 13:85966956-85966978 CAGCTTCTGCCTGAGCCCCCAGG + Intergenic
1112310458 13:98313465-98313487 CAGATTCTCCCAGAACCTTCAGG + Intronic
1112366920 13:98763182-98763204 CTCCTTCTCACTGGGCCTCCAGG + Intergenic
1112452221 13:99522975-99522997 AACATTTTCCCTGAGTCTTCTGG + Intronic
1112455115 13:99553267-99553289 CAGCTTCTGCCAGGGCCTTCCGG - Intronic
1114627432 14:24138611-24138633 CACCCACTCCCTGACCCTGCAGG + Exonic
1115439826 14:33421117-33421139 CAGCGTCTCCTTGAGGCTTCAGG - Intronic
1115716111 14:36105370-36105392 CACATTCTCCCTGAGCATTAGGG - Intergenic
1116195159 14:41715919-41715941 AAACTTCTCCCTGGGCATTCAGG + Intronic
1119749109 14:77065025-77065047 CTGCTTCCCCCTGAGCCTTTGGG + Intergenic
1121533753 14:94677047-94677069 TACCTACTCCCTGACCCTTCAGG + Intergenic
1121548729 14:94781959-94781981 CCCCTTCGCCCTGGGCTTTCTGG - Intergenic
1122166348 14:99827252-99827274 CATCTTCTCCCTGTGTCTTCAGG - Intronic
1122530022 14:102418937-102418959 CTCCTTCTCCCCGTGCCTCCAGG - Intronic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1124141853 15:27084205-27084227 CATCTTGTCCTTGAGCCTTTTGG + Intronic
1124556576 15:30731469-30731491 CACCTTCACCCCCAGCCTTTTGG + Intronic
1125720026 15:41840884-41840906 GAGCTTCTCACTGAGCCCTCAGG + Exonic
1125744271 15:41988121-41988143 CATCTTCTCCCTGAACCTGCTGG - Exonic
1125757111 15:42071516-42071538 CATTTTCTCCCTGAACCTGCTGG - Exonic
1128358703 15:66945695-66945717 CACCCTCTCCCTGATCCTGAGGG + Intergenic
1129071543 15:72955443-72955465 CAGCTTCTCCCTGAACTTCCTGG + Intergenic
1130063597 15:80587113-80587135 CACAGTCTTCCTGAGCCTTCTGG - Intronic
1130537812 15:84799524-84799546 CACCATCTGCCTGTGCCTTGGGG + Intronic
1131519532 15:93103002-93103024 CACTGTCTCCCTGAGCTTCCCGG - Intergenic
1131745882 15:95446702-95446724 CACTTTGTCCCTCAGCCTTTGGG - Intergenic
1131997498 15:98146233-98146255 CACTGTCCCCTTGAGCCTTCAGG + Intergenic
1132432981 15:101775489-101775511 CCCCTGCTCCCGGAGCCTCCAGG - Intergenic
1134975120 16:18564503-18564525 GTCCTTCTGCCTGAGTCTTCTGG - Intergenic
1135011862 16:18888307-18888329 CAACTTCTTTCTGAGCCTTTTGG - Intronic
1135318760 16:21475885-21475907 CAACTTCTTTCTGAGCCTTTTGG - Intergenic
1135371652 16:21907678-21907700 CAACTTCTTTCTGAGCCTTTTGG - Intergenic
1135440135 16:22463026-22463048 CAACTTCTTTCTGAGCCTTTTGG + Intergenic
1136329015 16:29557593-29557615 CAACTTCTTTCTGAGCCTTTTGG - Intergenic
1136443644 16:30297300-30297322 CAACTTCTTTCTGAGCCTTTTGG - Intergenic
1137289459 16:47042022-47042044 AACCTTCTCCCTGACCCTGCTGG + Intergenic
1137723693 16:50642714-50642736 CTCCTTTCCCATGAGCCTTCTGG - Intergenic
1138093676 16:54195830-54195852 CATCATCTCCCTGCCCCTTCTGG - Intergenic
1139321934 16:66121869-66121891 CACCTTCTCAGAGAGGCTTCTGG + Intergenic
1139654227 16:68377581-68377603 CAGCTGCCCCCTGAGCCCTCAGG - Intronic
1142304653 16:89278601-89278623 CACCTCCTCCCTTGGGCTTCTGG - Intronic
1142587186 17:980655-980677 CAGCTTCTCCCTAAGCATTGGGG - Intergenic
1143176289 17:4957032-4957054 CAGCTTCTCACTTGGCCTTCGGG - Exonic
1143321732 17:6072726-6072748 CACCTTCTCCCTGGGCCTCCTGG + Intronic
1143627878 17:8121562-8121584 GACCTTGGCCCTGAGCCTTGGGG - Exonic
1143963759 17:10741444-10741466 CACCTCCTCCCTGAGGCCTCTGG + Intergenic
1144120897 17:12151201-12151223 CACCTTCTACAGGAGCGTTCAGG + Intergenic
1144646951 17:16981513-16981535 CACCTTCACCATGAGCCGTGCGG - Intergenic
1144955845 17:19018370-19018392 CACCCCCTCCCCGAGCCTTGAGG - Intronic
1147725071 17:42561999-42562021 CACCCACTCCCAGAGCCTTCGGG + Intronic
1147918910 17:43904579-43904601 CACCTTCTCCCCTACCTTTCTGG - Intronic
1149679460 17:58495267-58495289 CACCTTCTCTCTGAGCCCACTGG + Exonic
1150809666 17:68346740-68346762 CACCTGCACCCTGGGCCTCCTGG + Intronic
1151759438 17:76092202-76092224 CCCTTTCTCCCTCAGCTTTCTGG - Intronic
1152183612 17:78840613-78840635 CACGTTCTCCCTGAGCGTCCCGG + Exonic
1152265180 17:79290004-79290026 CACCTTCTGTCTGAACCCTCTGG - Intronic
1152313532 17:79566125-79566147 CACCTTCTCCCTGTTCCTTGTGG - Intergenic
1152784071 17:82238991-82239013 TACCTCCTCCCTGTGCCTGCCGG - Exonic
1152801838 17:82334253-82334275 CACCTGCGGCCTGGGCCTTCAGG + Intergenic
1152856056 17:82664918-82664940 CACCTCCTCCCCAAGCCTGCAGG + Intronic
1153547172 18:6219750-6219772 CCCCTTCTTCCTGAGCGTTCAGG - Intronic
1155217546 18:23656853-23656875 GACCTTCCCTCTGTGCCTTCTGG + Intronic
1156520929 18:37721796-37721818 CAGCTTCTCCCTGTCCCTTGTGG + Intergenic
1157221707 18:45832863-45832885 CACCCTCACCCTGAGTCCTCTGG + Intronic
1159110719 18:64053418-64053440 CACCTTCCCAGTGAACCTTCAGG - Intergenic
1159207783 18:65275641-65275663 TACGTTCTACTTGAGCCTTCAGG - Intergenic
1160076086 18:75679219-75679241 CAGCTCCTCCCTGTTCCTTCAGG + Intergenic
1160143138 18:76343791-76343813 CACCTCCTCCATGAATCTTCTGG + Intergenic
1161961143 19:7523829-7523851 CACCCTCTCCCTGAGCCTTGAGG - Intronic
1162634287 19:11954712-11954734 CTCCTTCTGCCTCAGCCTCCTGG - Intronic
1163497046 19:17652662-17652684 CTCCTTCTCCCCGGGCCTGCAGG + Exonic
1163530943 19:17848435-17848457 CAGCGTCTCCCTGAGTCTTAAGG - Intergenic
1163655850 19:18544230-18544252 CACCTTCTTCCCGAGCCATGGGG - Intergenic
1163686966 19:18717281-18717303 CACCCTCTCCCAGGGTCTTCAGG + Intronic
1163806857 19:19405080-19405102 CACCTTCTCCCTGAGGCACGAGG + Intronic
1164668009 19:30054526-30054548 CAACTCCTCCCTGAGTCTCCAGG - Intergenic
1165431755 19:35776880-35776902 GAAGTTCTCCCTGACCCTTCAGG - Intronic
1165964849 19:39567967-39567989 CACCTTCTTCATGAGACTTTTGG + Intergenic
1165966823 19:39588459-39588481 CACCTTCTTCCTGAGCCTTTTGG - Intergenic
1165972511 19:39644002-39644024 CACCTTCTCCTTGAGCCTTTTGG - Intergenic
1165974360 19:39661666-39661688 CACCTTCTCCATGAGCCTTTTGG - Intergenic
1165978366 19:39697405-39697427 CACCTTCTTCCTGAGCCTTTTGG - Intergenic
1165979762 19:39710407-39710429 CACTGTCTCCATGAGCCTTTTGG - Intergenic
1166091918 19:40514765-40514787 CAACTCCACCCTGAGCCCTCTGG - Intronic
1166717357 19:44977102-44977124 CAGCTTCTCTCTGAGCCTCAGGG - Intronic
1166822632 19:45589933-45589955 CACCTTCTTCCCAAACCTTCTGG + Exonic
1166886625 19:45965173-45965195 CCCCATCTTTCTGAGCCTTCTGG - Intronic
1167171646 19:47836274-47836296 CACCTTCACCCGGAGCCAACTGG + Exonic
1167575079 19:50314157-50314179 GACCTGCTCCCTCAGCCTTTAGG - Intronic
1167590610 19:50402516-50402538 CACCTTCTCCTTCAGCCTCAGGG - Exonic
1168720936 19:58554731-58554753 AACCGTCTCCCTCAGCATTCAGG - Intronic
925711046 2:6740354-6740376 CACCTTCTTCATAAGCCGTCAGG - Intergenic
925778142 2:7355077-7355099 CACCTACTCCCTGGTGCTTCAGG + Intergenic
926148731 2:10412746-10412768 TACCCTATCCCTGAGCCTTCTGG + Intronic
926395762 2:12440733-12440755 CTCCTCCTCCCTGAGGGTTCAGG - Intergenic
927770447 2:25856454-25856476 CAGCTTCTCACTTGGCCTTCGGG + Intronic
927847897 2:26480717-26480739 CCCCTTCTCCCTGAGTCACCTGG - Intronic
929336603 2:40755131-40755153 TAGCTTCTCCCTGATTCTTCAGG - Intergenic
929563635 2:42970924-42970946 CACCTGCTCCTGGAGCCTCCAGG - Intergenic
929592796 2:43158026-43158048 CAGCCTCTCCATGAGCCATCAGG + Intergenic
930371498 2:50507114-50507136 TACCTTCTCCCAGAGTCTACTGG - Intronic
931640011 2:64373738-64373760 CATCTCCTCCATGAGCGTTCTGG - Intergenic
931693255 2:64853030-64853052 CCTCTTCTCCCTGGGTCTTCTGG + Intergenic
932337435 2:70939041-70939063 CACCTCCTCCCTGATCCCGCTGG - Intronic
935116632 2:100142802-100142824 GACCTTCTCCCTTGGCCTCCAGG - Intergenic
938307003 2:130263405-130263427 CGCTTGCTCCCTGAGCCTGCAGG + Intergenic
940861891 2:158779297-158779319 TACCTTCTCCTGGAGCCCTCAGG + Intergenic
941657549 2:168160073-168160095 GAGCCTCTCCCTGAGCCTTCTGG - Intronic
943535624 2:189146119-189146141 TACCTTCTCCCAGATCTTTCTGG - Intronic
944019233 2:195080997-195081019 CATCTTCTCCCTGGGTTTTCTGG + Intergenic
945442535 2:209896860-209896882 CACCTCCTGCCTGTGCCCTCTGG - Intronic
945702785 2:213191813-213191835 TACCTTCTCCCTATGTCTTCAGG + Intergenic
946856084 2:223951096-223951118 CACCTTCTTCCTTTGTCTTCAGG - Intergenic
947596473 2:231415165-231415187 CACCTTGTCCCTCAGTCTTCAGG - Intergenic
947750408 2:232529186-232529208 CACCTTCTCTCTCTGCCTTTGGG - Intronic
948253711 2:236551187-236551209 CCTCTTCTCCCTCAGCCTCCCGG + Intergenic
948695181 2:239729671-239729693 CACCCTGTCCCAGGGCCTTCTGG + Intergenic
948797429 2:240412141-240412163 CACCTTCTCCCGGATCCTCCAGG + Intergenic
1169213183 20:3778777-3778799 CACCTTCACCTCGGGCCTTCTGG + Exonic
1172175027 20:32966951-32966973 CACCTTCTCCCTAAGGCATAGGG + Intergenic
1172241991 20:33419229-33419251 CACCTGCTCCCAGGGCCATCTGG + Intronic
1173333625 20:42096060-42096082 CACCTGCTCCCTAAACCTTGGGG + Intronic
1174513321 20:51072577-51072599 GACCTTGTACCTCAGCCTTCTGG + Intergenic
1175352754 20:58337004-58337026 CATCTTCTCCCTCAACTTTCTGG + Intronic
1175492689 20:59389843-59389865 CACCATCTCCCAGAGCCCCCTGG - Intergenic
1175496081 20:59415350-59415372 CCCCTACTCCCTGAACCTTGGGG - Intergenic
1176057435 20:63156034-63156056 CACCTTCTCCCGCAGGCTCCTGG - Intergenic
1176109790 20:63406031-63406053 CGTCTTCTCCCTGTACCTTCTGG - Intronic
1176423122 21:6532310-6532332 CACCTTGGCACTGAGCCTCCAGG - Intergenic
1176672382 21:9746553-9746575 CACTTTCTCACTGAGGCTGCAGG - Intergenic
1179156763 21:38857769-38857791 CACCTTCTCCATGGACCTGCTGG - Intergenic
1179629148 21:42666031-42666053 CACCTTCCCCAAGGGCCTTCAGG + Intronic
1179698615 21:43140626-43140648 CACCTTGGCACTGAGCCTCCAGG - Intergenic
1179725626 21:43339921-43339943 TGGCTTCTCCCTGAGCCTGCAGG + Intergenic
1179991344 21:44949635-44949657 CCGCTTCTGCCTGCGCCTTCCGG + Intronic
1181576980 22:23801433-23801455 CACCATTTCCCAGAGCCTGCTGG + Intronic
1181748558 22:24973082-24973104 CCCTTGCTCCCTGTGCCTTCAGG - Intronic
1184059687 22:42074354-42074376 CACCTCCTCCCGGAGCCCGCCGG - Intronic
1184655140 22:45937274-45937296 CACATGCTCCTGGAGCCTTCTGG + Intronic
949861364 3:8508188-8508210 GACCTTGTCCCAGAGCTTTCAGG + Intronic
950029362 3:9842009-9842031 CTCCTGCTCCCTGAGCCCTAGGG + Exonic
950331151 3:12157333-12157355 CACTTTCTCCATCAGCCTTAGGG + Intronic
950485203 3:13269264-13269286 CACCTTCTCCCTGAGCACTAAGG - Intergenic
952817238 3:37456325-37456347 CTCCCACTCCCTGAGTCTTCTGG + Intronic
953025345 3:39141880-39141902 CACCTTGTACCTGAGCTTACAGG - Exonic
953866153 3:46585057-46585079 CACCTTCTCCCAGAGGCTGGGGG - Intronic
954334976 3:49911039-49911061 CTCCTTCTCCCTGAGGGCTCAGG + Intronic
954354395 3:50072815-50072837 CACCTTGGCCTTGAGTCTTCTGG + Intronic
955350417 3:58189289-58189311 GACCTTCTCCCTGACCCTGCTGG - Intergenic
958258430 3:91351695-91351717 GACCATCTCCCAGAGCCTCCTGG - Intergenic
958461127 3:94397262-94397284 CTCCTACTCCCTCATCCTTCTGG - Intergenic
958986599 3:100786653-100786675 CACCTTCTCTCAGATCCTTTTGG - Intronic
959918618 3:111846493-111846515 AAGCTTATCCCTCAGCCTTCTGG - Intronic
962061794 3:131935659-131935681 TATCTTCTCCCTGAATCTTCTGG - Intronic
962236555 3:133712031-133712053 AACCTTCTCCCTGACCCCTAGGG + Intergenic
964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG + Intergenic
968297719 3:197590523-197590545 GAGCTCCTCCCTGAGCCTGCAGG - Intergenic
970609798 4:17714454-17714476 GGCCTTCTCCCTGGTCCTTCAGG - Intronic
971395512 4:26223424-26223446 CAGATTTTCCCTGAGCCCTCAGG - Intronic
971635578 4:29052945-29052967 CATCCTTTCCTTGAGCCTTCTGG + Intergenic
972100359 4:35407725-35407747 AAACTTCTGCCTGGGCCTTCAGG - Intergenic
976201697 4:82585604-82585626 CAACTTTTCCCTGAGAGTTCTGG + Intergenic
976288622 4:83394775-83394797 GACATTCTCTCTGAGACTTCAGG - Intergenic
976503126 4:85814891-85814913 AACCTTCTGCCTGAGCATCCAGG + Intronic
978091053 4:104715412-104715434 CACTTTCTCCCTGAGGAGTCTGG - Intergenic
981562308 4:146061572-146061594 ATCCTTCTCCCTCAGCTTTCTGG + Intergenic
982187774 4:152819796-152819818 CTCCTTCTCCAAGACCCTTCAGG - Intronic
984024144 4:174522621-174522643 CACCTGCCCCCTGAGCGTTCTGG + Exonic
984327116 4:178268823-178268845 AAACTTCTGCCTGAGCATTCAGG + Intergenic
985402347 4:189605289-189605311 CACTTTCTCACTGAGGCTGCAGG + Intergenic
986463432 5:7996760-7996782 GTCAGTCTCCCTGAGCCTTCCGG + Intergenic
986741594 5:10710172-10710194 CCACCTCTCCCTGAGGCTTCGGG - Intronic
986982607 5:13466534-13466556 CAGATTCTCCCTGCTCCTTCAGG - Intergenic
986987597 5:13516721-13516743 GACATTCTCCCTGTGTCTTCAGG + Intergenic
987370675 5:17189814-17189836 CTCCTGCTCCCTGAGCCTCCTGG - Intronic
988578086 5:32445300-32445322 CACCCACTCCCTGAGCCATCCGG + Intergenic
988708066 5:33744918-33744940 ATCCTTCTGCCTCAGCCTTCTGG + Intronic
988868949 5:35366951-35366973 CTCCTTCTCCCTTAGCCCTTTGG - Intergenic
988929961 5:36027972-36027994 CACCATGTCCCAGAGCCTGCTGG - Intergenic
991297585 5:65098439-65098461 CACCTTCTCTCTTAGGTTTCAGG + Intergenic
992606792 5:78465797-78465819 CAACTTCTGCCTGAGAGTTCCGG - Intronic
992995172 5:82325319-82325341 CACATTCTCACTGTGCCTTCTGG + Intronic
995142549 5:108749311-108749333 CACCCGCCCCCTCAGCCTTCGGG - Intronic
996054674 5:118969405-118969427 CACCTTCTACAGGAGCATTCAGG + Intronic
997406934 5:133656544-133656566 CAGCTTCTGCTTGAGCGTTCTGG + Intergenic
997638738 5:135434810-135434832 CCCCTCCTCCCCGAGCCTGCAGG + Intergenic
1000190335 5:158904168-158904190 CAAATTCTGCCTGTGCCTTCTGG + Intronic
1002718858 5:181246132-181246154 CAGCGCCTCCCTGAGCCCTCGGG + Intronic
1003557325 6:7151702-7151724 CACCTTCTCCCTGACCCTGCAGG - Intronic
1003868743 6:10385193-10385215 CTCCTTCTCCTTGGGCTTTCCGG - Intergenic
1004126792 6:12881971-12881993 CACCTTCTGCCTTGGTCTTCAGG - Intronic
1005454209 6:26003516-26003538 AACTTTCTCCATGAGCATTCTGG + Intergenic
1005647752 6:27857335-27857357 CATCTTCTCCCTGTGTCTCCAGG - Intronic
1007071392 6:39040879-39040901 ACCCTTGTCTCTGAGCCTTCTGG - Intergenic
1007306232 6:40907553-40907575 CACCTGCTTCCTGAGGCTCCTGG - Intergenic
1008605894 6:53139418-53139440 AACCTTCTGCCTTAGCCTACTGG - Intronic
1008996831 6:57668992-57669014 GACCATCTCCCAGAGCCTCCTGG + Intergenic
1010193452 6:73216566-73216588 CACCTGCTACCTCTGCCTTCTGG - Exonic
1010258079 6:73783153-73783175 CCCCTTCTCCCTGTGACTCCTGG - Intronic
1013462933 6:110392976-110392998 CACCTTCTCCCTGATGTTGCAGG + Exonic
1015310596 6:131762732-131762754 AGTCTTCTCCCTGAGTCTTCAGG - Intergenic
1016565329 6:145445939-145445961 CACCTTCTGCCTGACTCTTTGGG + Intergenic
1016769864 6:147837253-147837275 CATCTTATCCCAGAGTCTTCTGG - Intergenic
1018029323 6:159829817-159829839 CAGCTTCTCTCTGAGGCCTCTGG - Intergenic
1018792262 6:167157597-167157619 CGCCTTCTACCTGAGCCTCCAGG - Exonic
1019288048 7:233537-233559 CGGCTCCTCCCTGAGCCTCCCGG - Intronic
1019815650 7:3197862-3197884 CCCCTCCCCCCTGAACCTTCAGG + Intergenic
1019958254 7:4434503-4434525 CACCTTCTTCGTGCACCTTCTGG - Intergenic
1021971557 7:25970079-25970101 CACCTTCTCCCAAAGACTTGAGG + Intergenic
1022658569 7:32344608-32344630 CACCTTCTCAGTGAGTTTTCTGG + Intergenic
1023178068 7:37452901-37452923 CACCTCCTCACTCACCCTTCAGG - Intergenic
1026965239 7:74435222-74435244 CAACCTCTCTCTGGGCCTTCTGG + Intergenic
1026991715 7:74589863-74589885 CACCTTCTCCCCGAGTCTGTTGG - Exonic
1029205755 7:98868631-98868653 CATCTTCTCCCTCACCCGTCGGG - Intronic
1029512753 7:101006718-101006740 AACCTTCTACCTTTGCCTTCAGG + Intronic
1030344277 7:108415163-108415185 CTTCTTGGCCCTGAGCCTTCTGG + Intronic
1032627320 7:133605972-133605994 CACCTTCTCACTTAGCTTCCAGG - Intronic
1032838370 7:135694423-135694445 AACCTTCTCCCCTAGCCTACTGG + Intronic
1033364105 7:140658373-140658395 CTCCTTCTCATTGGGCCTTCAGG + Intronic
1033424771 7:141234063-141234085 CACCTTCTCCCAGTGCAATCTGG - Intronic
1034244703 7:149635669-149635691 CACCCTCTCCCTGGGCCTGGGGG + Intergenic
1034282969 7:149866301-149866323 CACCGTCTCCATGGGCGTTCAGG + Exonic
1034405901 7:150902256-150902278 CAGCTTGTCCCTGAGCCTGCAGG + Intergenic
1034430620 7:151039509-151039531 CACCTTCCTCCTCAGCCTCCTGG + Intronic
1035220387 7:157402870-157402892 CACTTTCTCCATCAGCCTTCTGG + Intronic
1035986495 8:4438287-4438309 CACCACCTCCATGAGCATTCAGG - Intronic
1036759259 8:11496051-11496073 CACCTTCTCTTTGAACATTCTGG + Intronic
1037586784 8:20282312-20282334 CAGCTGCTCTCTGAGCCTGCTGG + Intronic
1037930447 8:22877166-22877188 CACCTTATCCCTGAGGCTGAGGG - Intronic
1038612927 8:29071008-29071030 CACCTCCTACCTGAGGCTGCAGG - Intronic
1038662075 8:29506096-29506118 AACCTTCTCCCTGCTTCTTCTGG + Intergenic
1039542066 8:38381354-38381376 CCCCTTCTCCCAGACTCTTCTGG + Intronic
1039731782 8:40287463-40287485 AACAGTCTCCCTGAGCATTCTGG + Intergenic
1040537750 8:48324333-48324355 GGCTTACTCCCTGAGCCTTCAGG + Intergenic
1041726624 8:61023859-61023881 CGGCTTCTCCCTGCGACTTCAGG - Intergenic
1042655581 8:71091916-71091938 CACCCTCTCTCCGAGCCTTCAGG - Intergenic
1043669392 8:82863035-82863057 CACATTTTCCCTGAGACTCCAGG + Intergenic
1043867783 8:85395260-85395282 GGCCTTCTCCCTAAGCTTTCAGG + Intronic
1044359460 8:91264511-91264533 CTCCTTATACCTGAGCCTCCTGG + Intronic
1045346060 8:101294734-101294756 CACTTTCTCCCTGTGCTATCAGG + Intergenic
1046087435 8:109455442-109455464 CCCCTTTTCCATGAGCCTCCAGG + Intronic
1047809937 8:128397391-128397413 CACATTTTCCCTGAGTCTTTGGG + Intergenic
1047940723 8:129825449-129825471 CACCTTCTCACTGTGTCCTCTGG + Intergenic
1048039349 8:130710517-130710539 CACCTGCTCCCTGAGGGTTAAGG + Intergenic
1048163140 8:132039025-132039047 CAACTCTTCCCTGAACCTTCTGG - Exonic
1048520053 8:135145569-135145591 GACCTTGGTCCTGAGCCTTCAGG + Intergenic
1049507193 8:143009048-143009070 CCCATTCTCCCTGAGTCTTGGGG + Intergenic
1050030219 9:1378228-1378250 TGCTTTCTCCCTGAGCCTTCTGG + Intergenic
1051360413 9:16277093-16277115 CACTTTCTCCCGGAGGCTGCAGG - Intergenic
1051607002 9:18926347-18926369 CACCTTCTGTCTGAGCCTACTGG - Intergenic
1052015083 9:23453760-23453782 GACCTTCTCCCTCTGCATTCAGG + Intergenic
1053749104 9:41235445-41235467 CACCCTCTCGCTGAGACTCCAGG + Intergenic
1054336760 9:63815304-63815326 CACCCTCTCGCTGAGACTCCAGG - Intergenic
1054804239 9:69382493-69382515 CACCTTCTGCCTTCCCCTTCAGG + Intronic
1055155342 9:73056336-73056358 CATCTTCTCCCAGACACTTCCGG - Intronic
1055424533 9:76180616-76180638 CACCTTCTCCCTCCTCCTTCAGG + Intronic
1055647213 9:78372613-78372635 CACTTTCTCCCTGTTCCTTGGGG + Intergenic
1055666182 9:78555352-78555374 CTCCTTCATCCTGAGCCTTCTGG - Intergenic
1057268018 9:93631616-93631638 CAGCTTGGCCCTGAGCTTTCTGG - Intronic
1057286266 9:93757103-93757125 CCCCTTCTCCAAGACCCTTCAGG + Intergenic
1057772499 9:97981471-97981493 CACCTCCTCCGGGAGCCATCAGG + Intergenic
1059408854 9:114119442-114119464 CATCCTCTCACTGAGTCTTCTGG - Intergenic
1060044052 9:120326060-120326082 CCGCCTCCCCCTGAGCCTTCTGG + Intergenic
1060291515 9:122307236-122307258 CACCTCCTCCCTGGGCTTCCGGG - Intronic
1060937910 9:127526686-127526708 TATCTTTTCCCTGAGCCCTCAGG - Intronic
1061442181 9:130613175-130613197 CACCTTTGCTCTGATCCTTCTGG - Intronic
1061794735 9:133079686-133079708 CTCCTTCTCACTGGGCCTCCAGG - Intronic
1061861126 9:133469299-133469321 CCCCTCCTCCCTGGGCCTGCTGG + Exonic
1062364861 9:136203675-136203697 CCCTTCCTCCCTGAGCCGTCCGG - Intronic
1062384992 9:136305677-136305699 CACCTTCTTCCAGAGCCTCCAGG - Intronic
1185748873 X:2594377-2594399 CTCCCTCTCCCTGACTCTTCTGG - Intergenic
1185790210 X:2923601-2923623 CATCTTCTCCCTGTGTCCTCAGG + Intronic
1185867444 X:3636508-3636530 CACCTGCTCCCACAGCCCTCTGG - Intronic
1186232739 X:7473284-7473306 CACCTCCTCCATGAAACTTCAGG + Intergenic
1189354064 X:40298321-40298343 CACCTTCTCCCTGACCTCTAAGG + Intergenic
1189839551 X:45059509-45059531 CTCCTTCTGCCTGAGTGTTCTGG - Intronic
1190157003 X:48002374-48002396 CAGTTTCTCTTTGAGCCTTCTGG - Intronic
1190777185 X:53562309-53562331 CACCTTCCCACTCAGCCTGCTGG - Intronic
1192184377 X:68936726-68936748 CTCCTTCTCCCTGTGCCTGGTGG + Intergenic
1193103369 X:77640693-77640715 TCCCTTTTCCCTGATCCTTCAGG - Intronic
1195731683 X:107974687-107974709 CACCATCTCCCTGTGACTGCAGG - Intergenic
1197249543 X:124200638-124200660 CACCTTCTCCAGTAGTCTTCTGG - Intronic
1200150069 X:153946991-153947013 CACCTTGCCCCGGAGCTTTCTGG + Intergenic
1200235704 X:154466829-154466851 CACCCAGTCCCTGAGCCCTCTGG - Intronic
1200308004 X:155047969-155047991 CTCCTTCCCCTTGACCCTTCAGG + Intronic
1201284102 Y:12364336-12364358 CATCTTCTCCCTGTGTCCTCAGG - Intergenic