ID: 1085395414

View in Genome Browser
Species Human (GRCh38)
Location 11:76204789-76204811
Sequence GGGTCTCGGTGTTCCCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085395404_1085395414 24 Left 1085395404 11:76204742-76204764 CCCACCACAGGCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 219
Right 1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
1085395406_1085395414 23 Left 1085395406 11:76204743-76204765 CCACCACAGGCCAGCGTGGGGGC 0: 1
1: 0
2: 0
3: 40
4: 351
Right 1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
1085395407_1085395414 20 Left 1085395407 11:76204746-76204768 CCACAGGCCAGCGTGGGGGCTTG 0: 1
1: 0
2: 2
3: 48
4: 218
Right 1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
1085395408_1085395414 13 Left 1085395408 11:76204753-76204775 CCAGCGTGGGGGCTTGCGTGCAT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 123
1085395400_1085395414 28 Left 1085395400 11:76204738-76204760 CCATCCCACCACAGGCCAGCGTG 0: 1
1: 0
2: 2
3: 37
4: 818
Right 1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085395414 Original CRISPR GGGTCTCGGTGTTCCCACTG TGG Intronic
900523265 1:3116333-3116355 GGCTCTCGGTTCTCACACTGTGG - Intronic
901207237 1:7504127-7504149 GGGACTCTGTGTCCTCACTGCGG + Intronic
902237537 1:15067189-15067211 TGGACTCTGTGTCCCCACTGTGG - Intronic
902368823 1:15993182-15993204 GGGTCTCTGTGTAGCCCCTGTGG - Intergenic
902377402 1:16036344-16036366 GGATCTCGCTGTTCCCCCAGGGG - Intergenic
902382579 1:16059602-16059624 GGATCTCGCTGTTCCCCCAGGGG - Exonic
903365115 1:22801430-22801452 GGGGCTCGGTTTCCCCTCTGTGG - Intronic
905791361 1:40791455-40791477 GGGGCTCTGTGTAGCCACTGAGG - Intronic
911550981 1:99280220-99280242 GAGTCTGGGTGTTCCCAATTTGG + Intronic
915507753 1:156368239-156368261 GGTTCCCTGTGTGCCCACTGTGG - Intergenic
916644530 1:166770018-166770040 GGGACTCAGAGTTCCCTCTGTGG - Intergenic
917906112 1:179588465-179588487 GGGTCTCGCAGTTCACACAGTGG - Intergenic
917959030 1:180127970-180127992 GGGCCTAGGACTTCCCACTGGGG + Intergenic
919296221 1:195703851-195703873 GGGTCTGGGGGGTCACACTGAGG + Intergenic
920987659 1:210905682-210905704 CCCTCTCGGTGTTCCCAGTGGGG + Intronic
923017438 1:230137620-230137642 GGGTCTTGATGCTTCCACTGGGG - Intronic
1064813690 10:19231806-19231828 GGGACTCGGTGATCCGACTTGGG - Intronic
1066653545 10:37680601-37680623 CGGTCTTGGTGTCCCCGCTGCGG + Intergenic
1067837634 10:49651351-49651373 TGGGCTCGGGGTTCCCACTCAGG + Intronic
1068753646 10:60625177-60625199 GTGCCTCGGTGTTCCCCTTGTGG - Intronic
1070775776 10:79108930-79108952 GGGCCTGGGTGTGCCCACTCAGG - Intronic
1073361786 10:102905285-102905307 GGGCCACCATGTTCCCACTGCGG - Intergenic
1076246426 10:128950715-128950737 GGGTCCCGGTGTGCTCTCTGGGG - Intergenic
1080510452 11:32964514-32964536 GGGTCTTGGGGTCCCCCCTGGGG + Intronic
1081585727 11:44382412-44382434 GGGGCTCACTGTCCCCACTGGGG + Intergenic
1083262339 11:61530084-61530106 GTTTCCCGGTGTTCCAACTGTGG + Intronic
1085395414 11:76204789-76204811 GGGTCTCGGTGTTCCCACTGTGG + Intronic
1085619022 11:78023292-78023314 GAGCCTCGGTGTTCCCACCTAGG - Exonic
1085766525 11:79287974-79287996 GGCTGTTGGGGTTCCCACTGAGG - Intronic
1094240802 12:28222171-28222193 TGGTCTCTGTGTTTCCACTTTGG + Intronic
1102760922 12:115384265-115384287 GGGCCTCAGTGTTCTCTCTGGGG + Intergenic
1107361155 13:39618948-39618970 GGGTCTTGCTGTGGCCACTGTGG - Intergenic
1112591214 13:100764523-100764545 TAGTCTCACTGTTCCCACTGTGG + Intergenic
1113643260 13:111973453-111973475 GGGGCTCTGTGTTCCAACAGAGG + Intergenic
1119373357 14:74166911-74166933 GGGTCTGGGTGTTCTCTCTGGGG + Intronic
1122482348 14:102055302-102055324 CGGTCTCGGTGTTCCCAGCCTGG - Intergenic
1128086757 15:64891921-64891943 GGGTCTAGGTGTTTCCACAGTGG + Intronic
1132040343 15:98520261-98520283 GGTTTTCTGTCTTCCCACTGGGG - Intergenic
1132203484 15:99970892-99970914 GGCTGTGGTTGTTCCCACTGTGG + Intergenic
1142193451 16:88728445-88728467 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193470 16:88728530-88728552 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193550 16:88728955-88728977 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193569 16:88729040-88729062 GGGTCACGAGGTTCCCTCTGTGG - Intronic
1142193588 16:88729125-88729147 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193607 16:88729210-88729232 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193626 16:88729295-88729317 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193645 16:88729380-88729402 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193679 16:88729550-88729572 GGGTCACGAGGTTCCCTCTGTGG - Intronic
1142193699 16:88729636-88729658 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1142193735 16:88729806-88729828 GGGTCGCGAGGTTCCCTCTGTGG - Intronic
1143205902 17:5139139-5139161 GGGTCTCTGTGTGGCCCCTGTGG - Intronic
1144813233 17:18015440-18015462 GGTTCTAGGTGTTGACACTGTGG - Intronic
1144957537 17:19026698-19026720 GGGCCTCAGTTTCCCCACTGGGG - Intronic
1144977619 17:19147818-19147840 GGGCCTCAGTTTCCCCACTGGGG + Intronic
1145012734 17:19378834-19378856 GGGCCTCAGTGTCCCCTCTGCGG - Intronic
1145761779 17:27429620-27429642 GGGTCTCTGTGTGGCCCCTGTGG - Intergenic
1146229449 17:31095167-31095189 GGCTCCCAGTGTTCCCACGGGGG - Exonic
1146954448 17:36929019-36929041 GTGTCTCTGTGTGCCCCCTGAGG - Intergenic
1150346059 17:64405642-64405664 AGGTGTCTGTGTTCCCACTGTGG + Intronic
1152527956 17:80900276-80900298 GGGTCTCCCTGCTTCCACTGTGG + Intronic
1153613311 18:6909815-6909837 GGTGCTCCGTGCTCCCACTGAGG + Intronic
1160738237 19:674491-674513 GGGACCCTGTGTTCTCACTGAGG - Intergenic
1160738308 19:674704-674726 GGGACCCTGTGTTCTCACTGAGG - Intergenic
1160893669 19:1392907-1392929 GGGGCTGGGTGTTGGCACTGTGG + Intronic
1161266951 19:3368566-3368588 GGGACTCGCTGTCCCCACTCTGG - Intronic
1162138284 19:8569603-8569625 GGGGCTCGGTGTTCCCCAAGTGG + Intronic
1165247136 19:34504310-34504332 GGTTCTCAGTGACCCCACTGAGG + Exonic
1165573760 19:36796832-36796854 GGGTCTCGGTGTTCACCGGGCGG + Intergenic
1166294135 19:41880780-41880802 GGGTGGGGGTGTTCCCTCTGGGG + Intronic
1166508814 19:43389913-43389935 GGGTCTCCCTGTCTCCACTGGGG + Intergenic
1166568454 19:43779254-43779276 GGGTCACTGTGTTCCCACCTCGG + Intronic
1167567330 19:50264883-50264905 GGGACTAGGTGTTCCCCCAGGGG + Intronic
925152840 2:1627419-1627441 GGGTTTCTTTGTTCCAACTGTGG - Intergenic
931769016 2:65481456-65481478 GGGTCTCTGTTTCTCCACTGTGG - Intergenic
931773157 2:65516991-65517013 GAGTCTCAGTGATCCCAGTGGGG + Intergenic
938068652 2:128295048-128295070 GGGTCTGGATGTGCCCAGTGAGG + Intronic
1173900399 20:46583531-46583553 GGGTCTCGGTGGGCTCAGTGAGG - Intronic
1174576914 20:51543113-51543135 GCGTCTCCGTGTGCCCACGGGGG + Intronic
1176025544 20:62983498-62983520 AGGTCTCTGTGTGCCCACTGAGG - Intergenic
1176089711 20:63313422-63313444 GGGTATAGGTGTTCCCCCAGTGG + Intronic
1176412240 21:6455310-6455332 GGGGGTCGGAGTTCCAACTGGGG - Intergenic
1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG + Intergenic
1179687734 21:43063632-43063654 GGGGGTCGGAGTTCCAACTGGGG - Intronic
1180081788 21:45490554-45490576 GGGTCTCCGTGTGCCCTCTCAGG + Intronic
1185014606 22:48335631-48335653 AGGTCCCTGTGTCCCCACTGTGG + Intergenic
952741462 3:36738482-36738504 GGGTCTCGGTCTCCCCACAGCGG + Exonic
953198225 3:40753939-40753961 GGGCCTCGGTGCTCACACTTGGG - Intergenic
953439732 3:42907086-42907108 GGGTCTCAGTCTCCACACTGTGG - Intronic
953926787 3:46986667-46986689 GGGTCTCTGTGGGGCCACTGAGG + Intronic
955401093 3:58592039-58592061 GGGTCCTGGTGTTTCCCCTGGGG + Intronic
955876322 3:63493413-63493435 GGGTCTCTGAATTCCCACAGTGG - Intronic
958756983 3:98260858-98260880 TGGTCTCAGTGTCCCCTCTGTGG + Intergenic
961644891 3:128387696-128387718 GGGTCTTGGTGGTGCCACAGGGG - Intronic
969640822 4:8397396-8397418 GGGTGAGGGTGCTCCCACTGTGG + Intronic
969672644 4:8598250-8598272 GGGACTGGGTTTCCCCACTGGGG - Intronic
970007834 4:11427975-11427997 GGGTCTAGGCGTTCCAACCGCGG + Intronic
970579849 4:17465197-17465219 GGGTCTCAGAGGTCCCAGTGAGG + Intronic
974067677 4:57094903-57094925 GAGTCACGGGGTCCCCACTGAGG + Intronic
978946757 4:114508680-114508702 TAGTCTCAGTGTTCCCCCTGAGG + Intergenic
981695673 4:147556626-147556648 GGATCTCAGTGGTCCCACTCTGG + Intergenic
985530335 5:430350-430372 GGGTCCTGGTGCTCCCACGGAGG - Intronic
986253247 5:6080536-6080558 GGGTCTCGGGGATTCCTCTGGGG + Intergenic
990129672 5:52565702-52565724 GGATGTCTGTGTTCTCACTGTGG - Intergenic
995484476 5:112626245-112626267 GGCCCTGGATGTTCCCACTGGGG + Intergenic
997206420 5:132052803-132052825 GGGTCTGGGTGGGCCCACTCAGG + Intergenic
1001306070 5:170574016-170574038 GGGTATCGGGGGTCCCACTTGGG - Intronic
1002522305 5:179798560-179798582 GGTGCTCGATGTTCCCACTGCGG + Exonic
1003677147 6:8215814-8215836 GGGCCTCCTTGTTCCCAGTGTGG + Intergenic
1004489826 6:16104016-16104038 GGGTCACGGTTCTCCAACTGGGG + Intergenic
1006536764 6:34705355-34705377 GGGTCTCTTTTTTCCTACTGTGG + Intergenic
1011677947 6:89753851-89753873 GTGTCACTGTGTTCCCACTCTGG - Intronic
1017853196 6:158324168-158324190 TTCTCTCAGTGTTCCCACTGAGG - Intronic
1019146581 6:169979102-169979124 GGTGCTCAGTGTTCCCACGGAGG - Intergenic
1021114066 7:16728968-16728990 GGGTGTCGACGTCCCCACTGTGG - Intergenic
1024037221 7:45517626-45517648 GTGTCTTGGTGTTCCCAGTAGGG + Intergenic
1027216877 7:76189508-76189530 GGGTCCCCGTGTTCCGACTGGGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1034451034 7:151137422-151137444 GGTTCTCGGAGTTCCAACTCAGG + Intronic
1035464694 7:159066924-159066946 GGATCTTGGTTTTCCTACTGAGG - Intronic
1037662975 8:20943019-20943041 GGGTCTATCTGTTCCCACTGAGG - Intergenic
1039546546 8:38414885-38414907 AGGTCTCGGTGTATGCACTGAGG + Exonic
1049207866 8:141371773-141371795 TGGTCCCAGTGTTCCCCCTGAGG - Intergenic
1049316935 8:141974365-141974387 GGGTCTCAGAGCTCCCACCGTGG + Intergenic
1049488663 8:142879535-142879557 GGCTCTGGGTGTTCCCAGCGAGG + Intronic
1049493562 8:142917562-142917584 GGATCTGGGTGTTCCCAGCGAGG + Intronic
1049553829 8:143272612-143272634 GGGTCTGGGTGTGCACCCTGTGG + Intronic
1058285352 9:103169973-103169995 TGGTCTCAGTGCTCCCTCTGTGG + Intergenic
1058876032 9:109245621-109245643 GGATCTCTGTGTTCTCAATGAGG - Intronic
1060772407 9:126342197-126342219 GGGACTGGGAGTTCCCGCTGTGG + Intronic
1061584342 9:131556268-131556290 GGGGCTCTGTGGACCCACTGGGG - Intergenic
1062052528 9:134455046-134455068 GGGGCTCAGGGTTCCTACTGGGG - Intergenic
1191109526 X:56793920-56793942 GGGGCTCCCTGTTCCCCCTGTGG + Intergenic