ID: 1085395746

View in Genome Browser
Species Human (GRCh38)
Location 11:76206395-76206417
Sequence GCCGCGCCCTCATCGTCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085395741_1085395746 23 Left 1085395741 11:76206349-76206371 CCGGTCTGGAGCGCCAGGGCGAA 0: 1
1: 0
2: 0
3: 9
4: 436
Right 1085395746 11:76206395-76206417 GCCGCGCCCTCATCGTCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 32
1085395744_1085395746 -8 Left 1085395744 11:76206380-76206402 CCTCGCAGACCTGCGGCCGCGCC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1085395746 11:76206395-76206417 GCCGCGCCCTCATCGTCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 32
1085395742_1085395746 10 Left 1085395742 11:76206362-76206384 CCAGGGCGAAGAGCAGCGCCTCG 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1085395746 11:76206395-76206417 GCCGCGCCCTCATCGTCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085395746 Original CRISPR GCCGCGCCCTCATCGTCGCG CGG Exonic
901303635 1:8217222-8217244 GCCGAGCCCTCCTCGTCACGGGG - Intergenic
901443223 1:9292344-9292366 CCCGCGCCCTCAGGGTCTCGAGG + Intergenic
914703019 1:150150605-150150627 GCCGCCCCGTCCTCGCCGCGCGG - Intronic
920600763 1:207321758-207321780 GGCGCGCCATGACCGTCGCGCGG + Exonic
923631125 1:235650005-235650027 GCCGCGCCCACTCCGCCGCGGGG + Intronic
1072059784 10:91798611-91798633 GCCTCGCCCTCCTGCTCGCGGGG + Exonic
1081652316 11:44832630-44832652 GCGGCACCCTCATTGTCCCGGGG + Intronic
1084161529 11:67353041-67353063 TCCGCTTCCTCCTCGTCGCGGGG + Exonic
1085395746 11:76206395-76206417 GCCGCGCCCTCATCGTCGCGCGG + Exonic
1123710085 15:22980470-22980492 GCCGCTCCCTCCTCCTGGCGGGG + Intronic
1123716698 15:23039163-23039185 GACGCGTCCTGATCGTCACGGGG - Intronic
1127960761 15:63888590-63888612 GCAGCGCCTTCATCCTCGTGAGG - Intergenic
1131231839 15:90665448-90665470 GCCGCGTCCTCACCGCCGCGGGG + Intergenic
1132879466 16:2155645-2155667 CCGGCGGCCTCGTCGTCGCGGGG - Intergenic
1138327956 16:56191299-56191321 CCCGCGCCCTCCCCGTCCCGGGG + Intergenic
1142670486 17:1485600-1485622 GCCGCGCCCGCTTCCTGGCGAGG + Intronic
1145252635 17:21304819-21304841 GCCCCGCCCTCATTGTCAGGAGG + Intronic
1145323930 17:21783090-21783112 GCCCCGCCCTCATTGTCAGGAGG - Intergenic
1152132306 17:78484811-78484833 GCCCCGCCCTCACCGCCCCGGGG + Intronic
1160464909 18:79068809-79068831 CACGCGCCCTCCTCGCCGCGCGG - Intergenic
1160966720 19:1749915-1749937 GCCGCGCGCTCAGCCTCGCCGGG + Intergenic
1164454760 19:28397879-28397901 GCCTCTCCCTCATCTTCACGTGG - Intergenic
1179810229 21:43865315-43865337 GCCGCCACCTGCTCGTCGCGCGG - Intronic
1181745703 22:24953579-24953601 GCCGCGCCGCCATCGGGGCGGGG - Intronic
1185272703 22:49936108-49936130 GCCCCGCGCTCCTCGTCGCTGGG + Intergenic
1185332394 22:50257613-50257635 GCCGCGCCCCCATCGCCCCCAGG - Intronic
968583611 4:1406011-1406033 GCCGCGCCCTCGCCGGCGCCGGG - Exonic
976246801 4:83012805-83012827 GCCGCCGCCTCCTGGTCGCGCGG + Intronic
976431403 4:84966490-84966512 GCCGCGTCCTCGTCCTCGCTGGG + Intergenic
1007662018 6:43492581-43492603 GCCTCGCCCACATCGTCTCCGGG - Intronic
1010107081 6:72182657-72182679 GCCGCGCCCGCCTCGGTGCGCGG - Exonic
1033654304 7:143362622-143362644 GCCGGGCCCTCACCGACTCGGGG + Exonic
1042229622 8:66542658-66542680 GCCGCGCCCTCAGCCTCTCCAGG + Intergenic
1062596559 9:137302365-137302387 GCCGCGCCCACATGGGGGCGGGG + Intergenic
1062653690 9:137591006-137591028 GCCGCGCCCTCCGGGTCGCGTGG - Intergenic
1199600734 X:149539982-149540004 GCCCCGCCCTGCTCTTCGCGGGG + Intergenic