ID: 1085398024

View in Genome Browser
Species Human (GRCh38)
Location 11:76217308-76217330
Sequence AGGGGTCCTGGCTGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085398012_1085398024 13 Left 1085398012 11:76217272-76217294 CCTCCTCCGTCTAGAGCAGAGAC No data
Right 1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG No data
1085398018_1085398024 -9 Left 1085398018 11:76217294-76217316 CCTCTGATTCCCCCAGGGGTCCT No data
Right 1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG No data
1085398014_1085398024 7 Left 1085398014 11:76217278-76217300 CCGTCTAGAGCAGAGACCTCTGA No data
Right 1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG No data
1085398013_1085398024 10 Left 1085398013 11:76217275-76217297 CCTCCGTCTAGAGCAGAGACCTC No data
Right 1085398024 11:76217308-76217330 AGGGGTCCTGGCTGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085398024 Original CRISPR AGGGGTCCTGGCTGTCTTCC TGG Intergenic
No off target data available for this crispr