ID: 1085399297

View in Genome Browser
Species Human (GRCh38)
Location 11:76225994-76226016
Sequence GGCCTTTGGGCTGGGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085399297_1085399312 30 Left 1085399297 11:76225994-76226016 CCTGCACACCCAGCCCAAAGGCC No data
Right 1085399312 11:76226047-76226069 GGCCCCATGCACGGCCACAGAGG No data
1085399297_1085399307 21 Left 1085399297 11:76225994-76226016 CCTGCACACCCAGCCCAAAGGCC No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399297_1085399305 9 Left 1085399297 11:76225994-76226016 CCTGCACACCCAGCCCAAAGGCC No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085399297 Original CRISPR GGCCTTTGGGCTGGGTGTGC AGG (reversed) Intergenic
No off target data available for this crispr