ID: 1085399305

View in Genome Browser
Species Human (GRCh38)
Location 11:76226026-76226048
Sequence ACATGAATAAACCAACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085399298_1085399305 1 Left 1085399298 11:76226002-76226024 CCCAGCCCAAAGGCCCCGAAGCA No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data
1085399295_1085399305 21 Left 1085399295 11:76225982-76226004 CCACTGCTGCATCCTGCACACCC No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data
1085399297_1085399305 9 Left 1085399297 11:76225994-76226016 CCTGCACACCCAGCCCAAAGGCC No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data
1085399301_1085399305 -5 Left 1085399301 11:76226008-76226030 CCAAAGGCCCCGAAGCACACATG No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data
1085399299_1085399305 0 Left 1085399299 11:76226003-76226025 CCAGCCCAAAGGCCCCGAAGCAC No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data
1085399300_1085399305 -4 Left 1085399300 11:76226007-76226029 CCCAAAGGCCCCGAAGCACACAT No data
Right 1085399305 11:76226026-76226048 ACATGAATAAACCAACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085399305 Original CRISPR ACATGAATAAACCAACCCCC AGG Intergenic
No off target data available for this crispr