ID: 1085399307

View in Genome Browser
Species Human (GRCh38)
Location 11:76226038-76226060
Sequence CAACCCCCAGGCCCCATGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085399298_1085399307 13 Left 1085399298 11:76226002-76226024 CCCAGCCCAAAGGCCCCGAAGCA No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399302_1085399307 0 Left 1085399302 11:76226015-76226037 CCCCGAAGCACACATGAATAAAC No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399300_1085399307 8 Left 1085399300 11:76226007-76226029 CCCAAAGGCCCCGAAGCACACAT No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399299_1085399307 12 Left 1085399299 11:76226003-76226025 CCAGCCCAAAGGCCCCGAAGCAC No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399304_1085399307 -2 Left 1085399304 11:76226017-76226039 CCGAAGCACACATGAATAAACCA No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399303_1085399307 -1 Left 1085399303 11:76226016-76226038 CCCGAAGCACACATGAATAAACC No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399301_1085399307 7 Left 1085399301 11:76226008-76226030 CCAAAGGCCCCGAAGCACACATG No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data
1085399297_1085399307 21 Left 1085399297 11:76225994-76226016 CCTGCACACCCAGCCCAAAGGCC No data
Right 1085399307 11:76226038-76226060 CAACCCCCAGGCCCCATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085399307 Original CRISPR CAACCCCCAGGCCCCATGCA CGG Intergenic
No off target data available for this crispr