ID: 1085400442

View in Genome Browser
Species Human (GRCh38)
Location 11:76232686-76232708
Sequence CCCAAGCCTCCACAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085400442_1085400449 7 Left 1085400442 11:76232686-76232708 CCCTGCATCTGTGGAGGCTTGGG No data
Right 1085400449 11:76232716-76232738 AGAGTGGAAAGAGAAGAGCGAGG No data
1085400442_1085400450 8 Left 1085400442 11:76232686-76232708 CCCTGCATCTGTGGAGGCTTGGG No data
Right 1085400450 11:76232717-76232739 GAGTGGAAAGAGAAGAGCGAGGG No data
1085400442_1085400445 -9 Left 1085400442 11:76232686-76232708 CCCTGCATCTGTGGAGGCTTGGG No data
Right 1085400445 11:76232700-76232722 AGGCTTGGGTCCTCCCAGAGTGG No data
1085400442_1085400451 9 Left 1085400442 11:76232686-76232708 CCCTGCATCTGTGGAGGCTTGGG No data
Right 1085400451 11:76232718-76232740 AGTGGAAAGAGAAGAGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085400442 Original CRISPR CCCAAGCCTCCACAGATGCA GGG (reversed) Intergenic
No off target data available for this crispr