ID: 1085400506

View in Genome Browser
Species Human (GRCh38)
Location 11:76232963-76232985
Sequence TATGCAGGACCACCCTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085400506_1085400518 27 Left 1085400506 11:76232963-76232985 CCCCCCTAGGGTGGTCCTGCATA No data
Right 1085400518 11:76233013-76233035 TTTTTTTTTTTTTTGAGGCAGGG 0: 803
1: 14764
2: 18397
3: 39449
4: 163102
1085400506_1085400516 22 Left 1085400506 11:76232963-76232985 CCCCCCTAGGGTGGTCCTGCATA No data
Right 1085400516 11:76233008-76233030 TTCTTTTTTTTTTTTTTTTGAGG 0: 315
1: 7007
2: 22453
3: 29955
4: 68271
1085400506_1085400517 26 Left 1085400506 11:76232963-76232985 CCCCCCTAGGGTGGTCCTGCATA No data
Right 1085400517 11:76233012-76233034 TTTTTTTTTTTTTTTGAGGCAGG 0: 833
1: 14576
2: 18633
3: 42286
4: 172953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085400506 Original CRISPR TATGCAGGACCACCCTAGGG GGG (reversed) Intergenic
No off target data available for this crispr