ID: 1085400833

View in Genome Browser
Species Human (GRCh38)
Location 11:76234615-76234637
Sequence ACTACCTTCCGCTCTCCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085400826_1085400833 26 Left 1085400826 11:76234566-76234588 CCGCTGGCTCTGCACTGCTAGTA No data
Right 1085400833 11:76234615-76234637 ACTACCTTCCGCTCTCCTACGGG No data
1085400829_1085400833 2 Left 1085400829 11:76234590-76234612 CCTTGTGATGGAGGCCAGCACAG No data
Right 1085400833 11:76234615-76234637 ACTACCTTCCGCTCTCCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085400833 Original CRISPR ACTACCTTCCGCTCTCCTAC GGG Intergenic
No off target data available for this crispr