ID: 1085401195

View in Genome Browser
Species Human (GRCh38)
Location 11:76236462-76236484
Sequence CCGCGCGGCGGAGGGAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085401188_1085401195 -3 Left 1085401188 11:76236442-76236464 CCAAAATGGAGACCTCTTGGCCG No data
Right 1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG No data
1085401186_1085401195 -1 Left 1085401186 11:76236440-76236462 CCCCAAAATGGAGACCTCTTGGC No data
Right 1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG No data
1085401182_1085401195 12 Left 1085401182 11:76236427-76236449 CCTTCCGCAGCTACCCCAAAATG No data
Right 1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG No data
1085401184_1085401195 8 Left 1085401184 11:76236431-76236453 CCGCAGCTACCCCAAAATGGAGA No data
Right 1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG No data
1085401187_1085401195 -2 Left 1085401187 11:76236441-76236463 CCCAAAATGGAGACCTCTTGGCC No data
Right 1085401195 11:76236462-76236484 CCGCGCGGCGGAGGGAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085401195 Original CRISPR CCGCGCGGCGGAGGGAGCAC CGG Intergenic