ID: 1085402941

View in Genome Browser
Species Human (GRCh38)
Location 11:76245455-76245477
Sequence GCTGAAGCCCAGAGGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085402934_1085402941 12 Left 1085402934 11:76245420-76245442 CCTGGTGCCTTTTGGGAACAGAA No data
Right 1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG No data
1085402933_1085402941 15 Left 1085402933 11:76245417-76245439 CCACCTGGTGCCTTTTGGGAACA No data
Right 1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG No data
1085402935_1085402941 5 Left 1085402935 11:76245427-76245449 CCTTTTGGGAACAGAAGAATTTC No data
Right 1085402941 11:76245455-76245477 GCTGAAGCCCAGAGGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085402941 Original CRISPR GCTGAAGCCCAGAGGGTAGG AGG Intergenic
No off target data available for this crispr