ID: 1085403108

View in Genome Browser
Species Human (GRCh38)
Location 11:76246271-76246293
Sequence GTCCTCAGGGAGCTCGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085403108_1085403116 8 Left 1085403108 11:76246271-76246293 CCTTCACCGAGCTCCCTGAGGAC No data
Right 1085403116 11:76246302-76246324 CGAAGATGGTGCAGTGCTAGAGG No data
1085403108_1085403118 24 Left 1085403108 11:76246271-76246293 CCTTCACCGAGCTCCCTGAGGAC No data
Right 1085403118 11:76246318-76246340 CTAGAGGCCCCGACTGATTCGGG No data
1085403108_1085403119 30 Left 1085403108 11:76246271-76246293 CCTTCACCGAGCTCCCTGAGGAC No data
Right 1085403119 11:76246324-76246346 GCCCCGACTGATTCGGGCACTGG No data
1085403108_1085403112 -6 Left 1085403108 11:76246271-76246293 CCTTCACCGAGCTCCCTGAGGAC No data
Right 1085403112 11:76246288-76246310 GAGGACCCAGCCTGCGAAGATGG No data
1085403108_1085403117 23 Left 1085403108 11:76246271-76246293 CCTTCACCGAGCTCCCTGAGGAC No data
Right 1085403117 11:76246317-76246339 GCTAGAGGCCCCGACTGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085403108 Original CRISPR GTCCTCAGGGAGCTCGGTGA AGG (reversed) Intergenic
No off target data available for this crispr