ID: 1085406034

View in Genome Browser
Species Human (GRCh38)
Location 11:76262795-76262817
Sequence CTATGTATACGGAGAGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085406034_1085406037 -9 Left 1085406034 11:76262795-76262817 CCTGCATCTCTCCGTATACATAG No data
Right 1085406037 11:76262809-76262831 TATACATAGGCCACAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085406034 Original CRISPR CTATGTATACGGAGAGATGC AGG (reversed) Intergenic
No off target data available for this crispr