ID: 1085406037

View in Genome Browser
Species Human (GRCh38)
Location 11:76262809-76262831
Sequence TATACATAGGCCACAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085406031_1085406037 24 Left 1085406031 11:76262762-76262784 CCTCACAGAGACCCAAAATATAA No data
Right 1085406037 11:76262809-76262831 TATACATAGGCCACAATACAAGG No data
1085406032_1085406037 13 Left 1085406032 11:76262773-76262795 CCCAAAATATAAATCAAAATTAC No data
Right 1085406037 11:76262809-76262831 TATACATAGGCCACAATACAAGG No data
1085406033_1085406037 12 Left 1085406033 11:76262774-76262796 CCAAAATATAAATCAAAATTACC No data
Right 1085406037 11:76262809-76262831 TATACATAGGCCACAATACAAGG No data
1085406034_1085406037 -9 Left 1085406034 11:76262795-76262817 CCTGCATCTCTCCGTATACATAG No data
Right 1085406037 11:76262809-76262831 TATACATAGGCCACAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085406037 Original CRISPR TATACATAGGCCACAATACA AGG Intergenic
No off target data available for this crispr