ID: 1085407257

View in Genome Browser
Species Human (GRCh38)
Location 11:76270510-76270532
Sequence GCTGCTGGTGCCTCTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085407253_1085407257 -10 Left 1085407253 11:76270497-76270519 CCCCTCAGCAGAGGCTGCTGGTG No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407247_1085407257 7 Left 1085407247 11:76270480-76270502 CCACTCTGTCCCAGCCACCCCTC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407241_1085407257 20 Left 1085407241 11:76270467-76270489 CCAGCCCACACCCCCACTCTGTC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407251_1085407257 -7 Left 1085407251 11:76270494-76270516 CCACCCCTCAGCAGAGGCTGCTG No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407250_1085407257 -3 Left 1085407250 11:76270490-76270512 CCAGCCACCCCTCAGCAGAGGCT No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407249_1085407257 -2 Left 1085407249 11:76270489-76270511 CCCAGCCACCCCTCAGCAGAGGC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407244_1085407257 10 Left 1085407244 11:76270477-76270499 CCCCCACTCTGTCCCAGCCACCC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407245_1085407257 9 Left 1085407245 11:76270478-76270500 CCCCACTCTGTCCCAGCCACCCC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407243_1085407257 15 Left 1085407243 11:76270472-76270494 CCACACCCCCACTCTGTCCCAGC No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407242_1085407257 16 Left 1085407242 11:76270471-76270493 CCCACACCCCCACTCTGTCCCAG No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data
1085407246_1085407257 8 Left 1085407246 11:76270479-76270501 CCCACTCTGTCCCAGCCACCCCT No data
Right 1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085407257 Original CRISPR GCTGCTGGTGCCTCTCAGGC TGG Intergenic
No off target data available for this crispr