ID: 1085409054

View in Genome Browser
Species Human (GRCh38)
Location 11:76280997-76281019
Sequence CCACGAGTCCAGAGCTCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085409050_1085409054 6 Left 1085409050 11:76280968-76280990 CCATTGTTGGGCAGGGGTCCTCA No data
Right 1085409054 11:76280997-76281019 CCACGAGTCCAGAGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085409054 Original CRISPR CCACGAGTCCAGAGCTCAGA GGG Intergenic
No off target data available for this crispr