ID: 1085410571

View in Genome Browser
Species Human (GRCh38)
Location 11:76288150-76288172
Sequence GCCAGAGAAACCCCCTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085410562_1085410571 18 Left 1085410562 11:76288109-76288131 CCCTTCCTGCTTGGCCCACGTGC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410558_1085410571 26 Left 1085410558 11:76288101-76288123 CCCCTTTCCCCTTCCTGCTTGGC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410566_1085410571 4 Left 1085410566 11:76288123-76288145 CCCACGTGCACCTCCTGGAGTCT No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410559_1085410571 25 Left 1085410559 11:76288102-76288124 CCCTTTCCCCTTCCTGCTTGGCC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410569_1085410571 -9 Left 1085410569 11:76288136-76288158 CCTGGAGTCTCAGCGCCAGAGAA No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410561_1085410571 19 Left 1085410561 11:76288108-76288130 CCCCTTCCTGCTTGGCCCACGTG No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410568_1085410571 -6 Left 1085410568 11:76288133-76288155 CCTCCTGGAGTCTCAGCGCCAGA No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410563_1085410571 17 Left 1085410563 11:76288110-76288132 CCTTCCTGCTTGGCCCACGTGCA No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410560_1085410571 24 Left 1085410560 11:76288103-76288125 CCTTTCCCCTTCCTGCTTGGCCC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410564_1085410571 13 Left 1085410564 11:76288114-76288136 CCTGCTTGGCCCACGTGCACCTC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data
1085410567_1085410571 3 Left 1085410567 11:76288124-76288146 CCACGTGCACCTCCTGGAGTCTC No data
Right 1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085410571 Original CRISPR GCCAGAGAAACCCCCTCTGG AGG Intergenic
No off target data available for this crispr