ID: 1085419264

View in Genome Browser
Species Human (GRCh38)
Location 11:76341547-76341569
Sequence CTGCTCTTATTGATGTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085419261_1085419264 -3 Left 1085419261 11:76341527-76341549 CCTCTTCTAGGCCCATGTCTCTG No data
Right 1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG No data
1085419259_1085419264 21 Left 1085419259 11:76341503-76341525 CCTTCAGCAGGAAAGGGACAACA No data
Right 1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG No data
1085419257_1085419264 27 Left 1085419257 11:76341497-76341519 CCACTTCCTTCAGCAGGAAAGGG No data
Right 1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085419264 Original CRISPR CTGCTCTTATTGATGTCACA CGG Intergenic
No off target data available for this crispr