ID: 1085423207

View in Genome Browser
Species Human (GRCh38)
Location 11:76381067-76381089
Sequence TGCACCAGCGGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3043
Summary {0: 1, 1: 4, 2: 59, 3: 393, 4: 2586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085423207 Original CRISPR TGCACCAGCGGCGGCGGCGG CGG (reversed) Intergenic