ID: 1085424660

View in Genome Browser
Species Human (GRCh38)
Location 11:76393398-76393420
Sequence CACCTACTGCAACTGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085424656_1085424660 -5 Left 1085424656 11:76393380-76393402 CCTAACATCTCTTACTGTCACCT 0: 1
1: 0
2: 0
3: 20
4: 214
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1085424654_1085424660 7 Left 1085424654 11:76393368-76393390 CCATGTGATTTCCCTAACATCTC 0: 1
1: 0
2: 4
3: 18
4: 223
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1085424653_1085424660 17 Left 1085424653 11:76393358-76393380 CCTGGCAGGTCCATGTGATTTCC 0: 1
1: 0
2: 0
3: 13
4: 253
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1085424651_1085424660 26 Left 1085424651 11:76393349-76393371 CCCTGACATCCTGGCAGGTCCAT 0: 1
1: 0
2: 0
3: 38
4: 873
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1085424655_1085424660 -4 Left 1085424655 11:76393379-76393401 CCCTAACATCTCTTACTGTCACC 0: 1
1: 0
2: 0
3: 11
4: 174
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1085424652_1085424660 25 Left 1085424652 11:76393350-76393372 CCTGACATCCTGGCAGGTCCATG 0: 1
1: 0
2: 1
3: 10
4: 450
Right 1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085424660 Original CRISPR CACCTACTGCAACTGGACAG GGG Intronic
900970699 1:5991334-5991356 GACCTACGGAAACTGCACAGAGG + Intronic
901536040 1:9883515-9883537 CACATGCTCCAACAGGACAGGGG + Intronic
904097741 1:27994680-27994702 CAGCCACTGCACCTGGCCAGGGG - Intronic
904558750 1:31382819-31382841 CACCCACTGCAACTAGAGAGAGG + Intergenic
904737711 1:32647490-32647512 CACCAACTGGTACTGGCCAGGGG - Intronic
905790413 1:40786343-40786365 CACCAACAGCAGCTGGCCAGGGG - Intronic
907524354 1:55045577-55045599 CACCGGCTCCAACTGGGCAGAGG - Intronic
913578272 1:120198993-120199015 CACTTACAGCAACTTGACTGAGG + Intergenic
913629902 1:120699365-120699387 CACTTACAGCAACTTGACTGAGG - Intergenic
914560190 1:148810407-148810429 CACTTACAGCAACTTGACTGAGG + Intronic
914567299 1:148881051-148881073 CACGTACTGGAATTAGACAGTGG - Intronic
914605523 1:149249191-149249213 CACGTACTGGAATTAGACAGTGG + Intergenic
914612643 1:149319808-149319830 CACTTACAGCAACTTGACTGAGG - Intergenic
915128801 1:153683214-153683236 TCCCCACTGCAACTGGACACAGG - Intronic
916239064 1:162621335-162621357 CATCCTCTGCAACTGCACAGAGG + Intergenic
918271891 1:182909824-182909846 TACCTACTGCAATTGGCCAGAGG + Intronic
922067611 1:222159006-222159028 CACTCACTGCGACTGGCCAGGGG + Intergenic
1062893337 10:1083272-1083294 CTTCCACTGCAACTGGTCAGAGG - Intronic
1062949300 10:1485530-1485552 CACCCACTGCAAGTGGGCAGCGG - Intronic
1065716127 10:28570520-28570542 CTCCTATTGCAACAGGATAGTGG - Intronic
1067837135 10:49648490-49648512 CACAAACTGCAACAGGAAAGAGG - Exonic
1069356942 10:67597729-67597751 CACCTGCAGCAACAGGGCAGTGG + Intronic
1069801107 10:71082182-71082204 CACCAAATGCAACTGGCAAGTGG + Intergenic
1071052267 10:81465535-81465557 CATCTAATGCAAGTGGGCAGAGG + Intergenic
1072035486 10:91559379-91559401 CTCAGACTGCAACTGGACATTGG + Intergenic
1073453348 10:103622312-103622334 CACCTACTGCAGCTGGTGTGGGG - Intronic
1075803903 10:125171378-125171400 CACCCACTGCAGATGGAAAGTGG + Intergenic
1076653652 10:132007003-132007025 CACCTGCTGTAACTGCCCAGTGG + Intergenic
1078699871 11:13669424-13669446 CACCTACTGAAACCGGAAGGTGG + Intronic
1079373467 11:19871663-19871685 CACCCACTGCAAGTGGAAAATGG - Intronic
1081010593 11:37806568-37806590 CACAAACTGCAACTGAAAAGTGG + Intergenic
1085424660 11:76393398-76393420 CACCTACTGCAACTGGACAGGGG + Intronic
1088090928 11:106038518-106038540 CACCTACTGCATCAAGTCAGAGG + Intergenic
1089810787 11:121129787-121129809 CACATACTTCAATTGCACAGGGG + Exonic
1090079196 11:123600149-123600171 CACCTACTGGAACTGGGTAAGGG - Intronic
1090419257 11:126562759-126562781 CCCCTACAGCCACAGGACAGAGG - Intronic
1095502413 12:42855032-42855054 CACCTACTGCAATTCCAGAGTGG + Intergenic
1095871505 12:47033346-47033368 CACCTATTGTAACTGGTCATTGG + Intergenic
1098190301 12:67941043-67941065 CTCCTTTTGCAAATGGACAGTGG - Intergenic
1103404717 12:120667076-120667098 TAACTCCTGCAACTGGAAAGCGG + Exonic
1104431124 12:128717233-128717255 CAGGTACTGCACCTGGACTGTGG - Intergenic
1106428349 13:29655563-29655585 CTCCTACTGCCTCTGGGCAGAGG + Intergenic
1107318561 13:39160915-39160937 CACCTTCGGCAAGTGGGCAGAGG - Intergenic
1107835022 13:44406016-44406038 CCCTCACTGCACCTGGACAGCGG + Intergenic
1115137839 14:30132438-30132460 CACCTACTGCAGCAGGTAAGTGG - Intronic
1115754285 14:36517693-36517715 CAGCAACTGCAGCAGGACAGCGG - Exonic
1117323842 14:54650481-54650503 CAGCTCCTGCGACTGGACTGTGG + Intronic
1117589374 14:57250779-57250801 TAGCTACCTCAACTGGACAGGGG - Intronic
1118616723 14:67579155-67579177 CACCTACTGCCAGCGGGCAGTGG + Exonic
1119104653 14:71912690-71912712 CCACCACTCCAACTGGACAGAGG + Intergenic
1121546131 14:94765029-94765051 CACCTACAGCAAATGGCCACAGG - Intergenic
1122200652 14:100120658-100120680 GACCTCCTGCACCTGGACACTGG - Intronic
1124853590 15:33365002-33365024 CACATACTGAAGATGGACAGAGG + Intronic
1130316228 15:82799420-82799442 CACCTAGAGCAAGTGGAGAGTGG - Intronic
1130395312 15:83496072-83496094 GAGCTACTGCACCTGGCCAGTGG - Intronic
1131032205 15:89195672-89195694 CAGATGCTGAAACTGGACAGAGG - Exonic
1133587958 16:7213985-7214007 CACCTGCTCCATCAGGACAGTGG - Intronic
1140902774 16:79384911-79384933 CACCTTATGCACCAGGACAGAGG + Intergenic
1141832966 16:86519962-86519984 CACCTCCCGCACCTGGACAGAGG - Intergenic
1149752506 17:59159465-59159487 AACCTACTGCAACTGTCTAGGGG - Intronic
1152851103 17:82636509-82636531 CACCTCCTGCAGCTGAAGAGGGG + Intronic
1154523361 18:15254381-15254403 CACCTACTTCAAGTGGCCATGGG - Intergenic
1157194438 18:45609220-45609242 CACCTACTGCTCCTGCACTGTGG + Intronic
1161719565 19:5895459-5895481 CTCCCACTGGAACTGGTCAGAGG - Intronic
1167416506 19:49375985-49376007 CACCTGCAGTAACTGGAGAGAGG - Intergenic
926221668 2:10940123-10940145 CTACAACTCCAACTGGACAGAGG + Intergenic
927215229 2:20664828-20664850 CACATACAGCGAGTGGACAGTGG + Intergenic
931336501 2:61349554-61349576 GACCCACTGCATCTGGCCAGTGG - Intronic
932455564 2:71847419-71847441 CAGCTGCTGCAACAAGACAGAGG - Intergenic
940166539 2:150779872-150779894 CAGCAACTGCAATGGGACAGAGG + Intergenic
940956453 2:159733520-159733542 GAGCTACTGCACCTGGCCAGAGG + Intronic
942139948 2:172967783-172967805 TCCCTAATGCAACAGGACAGAGG + Intronic
945097616 2:206234385-206234407 CATGTACAGCAACAGGACAGAGG - Intergenic
1170187807 20:13610917-13610939 CATCTATTGCAACAGCACAGAGG + Intronic
1171482501 20:25464663-25464685 CAGCTACTGCTTCAGGACAGTGG + Intronic
1172221628 20:33278095-33278117 CACCTTCATCAACTGGACTGTGG + Intronic
1172627337 20:36355108-36355130 GACCAACTACAAATGGACAGAGG - Intronic
1172693676 20:36807352-36807374 TCCCTACTGGATCTGGACAGGGG + Intronic
1173364397 20:42371855-42371877 TCCCTAGTTCAACTGGACAGGGG - Intronic
1174361306 20:50030320-50030342 CACGAACTGCATCTGGACAGGGG - Intergenic
1175525338 20:59629764-59629786 CACCCACTGCAACTGTATTGAGG - Intronic
1183586207 22:38754680-38754702 CACCTCCTTCAGCAGGACAGAGG - Intronic
950958521 3:17080214-17080236 AACCTACAGCAACAGGACACAGG - Intronic
951846749 3:27092774-27092796 CATCTAATGGAACTTGACAGTGG - Intergenic
956297179 3:67727582-67727604 ATCCTGCTGCTACTGGACAGAGG + Intergenic
958906735 3:99950147-99950169 CACCTACTGTAACTGTAGATAGG + Intronic
960236260 3:115285984-115286006 CACCTCCTGAAACTTGAAAGGGG - Intergenic
960761020 3:121074047-121074069 CATGTACTGCAACAGGACACAGG + Intronic
960868975 3:122230534-122230556 CACCCCCTGCAACAGGGCAGCGG + Intronic
969069420 4:4523100-4523122 CACCTCCTGCAACTGATCTGTGG - Intronic
969537469 4:7765534-7765556 CACCCAGTGCAGCTGCACAGAGG + Intronic
975676579 4:76833170-76833192 AACCCACTGCAATTGGAAAGAGG - Intergenic
984969562 4:185175558-185175580 GACCCACTGCATCTGGCCAGTGG + Intronic
985754697 5:1706470-1706492 CACCTACTGAAACTGTTCATGGG - Intergenic
985871753 5:2562923-2562945 CACCCAGAGCCACTGGACAGTGG + Intergenic
988188829 5:27901626-27901648 CACCACCTGAAAGTGGACAGTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991696784 5:69280399-69280421 CAGCTACTGCACCTGTGCAGAGG + Exonic
993799408 5:92313403-92313425 CACCTGCTGTCACTGGACTGAGG + Intergenic
994385835 5:99130446-99130468 CACGTACTCCATCTGGCCAGTGG - Intergenic
996492165 5:124110710-124110732 CACCTAAGGCAACTGGAAAGTGG - Intergenic
1001774170 5:174316203-174316225 CCCCTGCTGCAGCTGGACATGGG + Intergenic
1005106754 6:22232014-22232036 CACCTGCAGCAGCTGGGCAGTGG + Intergenic
1007378790 6:41473449-41473471 CAGCTGATGCAACTGGCCAGGGG - Intergenic
1008018414 6:46547646-46547668 CAGCTACTGGGAGTGGACAGGGG + Intergenic
1009922404 6:70078655-70078677 CACCAACTGCACCTGTACAGAGG + Intronic
1010902399 6:81443004-81443026 CAGCTACTGCAACGGGGCTGAGG - Intergenic
1014222725 6:118814775-118814797 CACCTTCTTCAACTCCACAGAGG - Exonic
1014398727 6:120960257-120960279 CACCTAATGCATGTGGACACTGG - Intergenic
1024457567 7:49626782-49626804 CAACAACTGCGAATGGACAGAGG + Intergenic
1028287530 7:89021631-89021653 CACCCACTGCAACTGCACCCAGG - Intronic
1030264078 7:107598785-107598807 CAGCCACTGCACCTGGCCAGTGG - Intronic
1036105558 8:5834231-5834253 AACCTGCTGCAATTGGTCAGTGG + Intergenic
1037014045 8:13880555-13880577 CCCCTACTGCAACTTGAGATAGG + Intergenic
1037284095 8:17277784-17277806 CACCTATTGCATTTGGATAGTGG + Intronic
1037854303 8:22359828-22359850 GACAAACTGCACCTGGACAGTGG + Intergenic
1040542213 8:48370432-48370454 CTCCTTATGCAACTGGGCAGAGG + Intergenic
1046029852 8:108770319-108770341 CTTCTACTGCAACTGGATAGAGG + Intronic
1048830263 8:138469551-138469573 CACCTATTACAACTGGACAATGG + Intronic
1051240951 9:15055113-15055135 CATCTACTCCAGCTGGCCAGTGG - Intergenic
1051933612 9:22416496-22416518 CACCTGCTGCAATTGTATAGTGG - Intergenic
1056647763 9:88429762-88429784 CACCCACTGTTACGGGACAGGGG - Intronic
1061792275 9:133064957-133064979 CACCTGCTGCACAGGGACAGGGG + Intronic
1185886611 X:3789025-3789047 CTCCTACTGTTACAGGACAGGGG + Intergenic
1186384478 X:9094770-9094792 CACCATCTGCCACTGGGCAGAGG + Intronic
1197316077 X:124967526-124967548 CACCTATTTCAACTGTAAAGTGG + Intergenic
1201464072 Y:14260635-14260657 CACTTTCTGCAACTGAAAAGTGG + Intergenic