ID: 1085428131

View in Genome Browser
Species Human (GRCh38)
Location 11:76422962-76422984
Sequence GGGACAGGTCCAACATGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085428125_1085428131 6 Left 1085428125 11:76422933-76422955 CCTAGAAAATAGCATTTTGGGGT No data
Right 1085428131 11:76422962-76422984 GGGACAGGTCCAACATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085428131 Original CRISPR GGGACAGGTCCAACATGCCA GGG Intergenic
No off target data available for this crispr