ID: 1085429689

View in Genome Browser
Species Human (GRCh38)
Location 11:76437333-76437355
Sequence ATGAACCCAGAAATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085429689_1085429694 -3 Left 1085429689 11:76437333-76437355 CCTTTCTCCATTTCTGGGTTCAT No data
Right 1085429694 11:76437353-76437375 CATGTCAGAGAATACACAGGGGG No data
1085429689_1085429692 -5 Left 1085429689 11:76437333-76437355 CCTTTCTCCATTTCTGGGTTCAT No data
Right 1085429692 11:76437351-76437373 TTCATGTCAGAGAATACACAGGG No data
1085429689_1085429691 -6 Left 1085429689 11:76437333-76437355 CCTTTCTCCATTTCTGGGTTCAT No data
Right 1085429691 11:76437350-76437372 GTTCATGTCAGAGAATACACAGG No data
1085429689_1085429693 -4 Left 1085429689 11:76437333-76437355 CCTTTCTCCATTTCTGGGTTCAT No data
Right 1085429693 11:76437352-76437374 TCATGTCAGAGAATACACAGGGG No data
1085429689_1085429695 22 Left 1085429689 11:76437333-76437355 CCTTTCTCCATTTCTGGGTTCAT No data
Right 1085429695 11:76437378-76437400 GCTTAGACTTTCATCCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085429689 Original CRISPR ATGAACCCAGAAATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr