ID: 1085430241

View in Genome Browser
Species Human (GRCh38)
Location 11:76441832-76441854
Sequence GAGGTTAAATAGCTGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085430241_1085430245 9 Left 1085430241 11:76441832-76441854 CCTTGGGCCAGCTATTTAACCTC No data
Right 1085430245 11:76441864-76441886 TAGTTTCTTCATTCATAAAATGG No data
1085430241_1085430247 11 Left 1085430241 11:76441832-76441854 CCTTGGGCCAGCTATTTAACCTC No data
Right 1085430247 11:76441866-76441888 GTTTCTTCATTCATAAAATGGGG No data
1085430241_1085430246 10 Left 1085430241 11:76441832-76441854 CCTTGGGCCAGCTATTTAACCTC No data
Right 1085430246 11:76441865-76441887 AGTTTCTTCATTCATAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085430241 Original CRISPR GAGGTTAAATAGCTGGCCCA AGG (reversed) Intergenic
No off target data available for this crispr