ID: 1085430247

View in Genome Browser
Species Human (GRCh38)
Location 11:76441866-76441888
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085430241_1085430247 11 Left 1085430241 11:76441832-76441854 CCTTGGGCCAGCTATTTAACCTC No data
Right 1085430247 11:76441866-76441888 GTTTCTTCATTCATAAAATGGGG No data
1085430242_1085430247 4 Left 1085430242 11:76441839-76441861 CCAGCTATTTAACCTCTCTATGC No data
Right 1085430247 11:76441866-76441888 GTTTCTTCATTCATAAAATGGGG No data
1085430243_1085430247 -8 Left 1085430243 11:76441851-76441873 CCTCTCTATGCCTTAGTTTCTTC No data
Right 1085430247 11:76441866-76441888 GTTTCTTCATTCATAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085430247 Original CRISPR GTTTCTTCATTCATAAAATG GGG Intergenic
No off target data available for this crispr