ID: 1085431543

View in Genome Browser
Species Human (GRCh38)
Location 11:76454918-76454940
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 494}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085431543_1085431558 24 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431558 11:76454965-76454987 TTGGGAGTACCTCTAGTCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1085431543_1085431556 6 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431556 11:76454947-76454969 CTTTAGCCATTTTGCTGCTTGGG 0: 1
1: 0
2: 2
3: 18
4: 270
1085431543_1085431561 29 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431561 11:76454970-76454992 AGTACCTCTAGTCAGAGGGTGGG 0: 1
1: 0
2: 1
3: 5
4: 116
1085431543_1085431555 5 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431555 11:76454946-76454968 CCTTTAGCCATTTTGCTGCTTGG 0: 1
1: 0
2: 2
3: 18
4: 185
1085431543_1085431559 25 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431559 11:76454966-76454988 TGGGAGTACCTCTAGTCAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1085431543_1085431560 28 Left 1085431543 11:76454918-76454940 CCCTCCTCCCCCTCCTAATACTG 0: 1
1: 0
2: 3
3: 42
4: 494
Right 1085431560 11:76454969-76454991 GAGTACCTCTAGTCAGAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085431543 Original CRISPR CAGTATTAGGAGGGGGAGGA GGG (reversed) Intronic
900540640 1:3200974-3200996 GAGGAAGAGGAGGGGGAGGAAGG + Intronic
901105386 1:6751863-6751885 GAGTAGGAGGAGGAGGAGGAGGG - Intergenic
901264915 1:7903032-7903054 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264924 1:7903059-7903081 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264933 1:7903086-7903108 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264942 1:7903113-7903135 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264956 1:7903158-7903180 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264970 1:7903203-7903225 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264979 1:7903230-7903252 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901264993 1:7903275-7903297 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901265002 1:7903302-7903324 CAGGAGAAGGAGGGGAAGGAGGG - Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901723064 1:11215985-11216007 CTGGATTTTGAGGGGGAGGAAGG - Intronic
901765250 1:11495863-11495885 CTGTAATAGGCAGGGGAGGAGGG - Intronic
902691370 1:18111802-18111824 CAGAACTAGGAGGGAGCGGAAGG - Intronic
903321188 1:22544101-22544123 AGGTATTAGGAGGTGGAGCAGGG + Intergenic
903534102 1:24055253-24055275 AAGTGTTAAGAGTGGGAGGATGG + Intergenic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
905182923 1:36177892-36177914 CAGGATGTGGAGGGAGAGGATGG - Exonic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906280416 1:44549631-44549653 CAGCAGGAGGAAGGGGAGGAAGG - Intronic
907259818 1:53209527-53209549 CATTATTAGGAGGCCGAGGCGGG + Intronic
907672683 1:56490482-56490504 CAGTAGTGTGATGGGGAGGAGGG - Intergenic
907964922 1:59319733-59319755 CTGTATTAGGCGGGGCTGGATGG + Intronic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909640461 1:77866482-77866504 CAGCTGTAGGAGGGGTAGGAGGG + Intronic
911392075 1:97258109-97258131 ATGGATTAGGAGGGAGAGGAAGG + Intronic
912285548 1:108364854-108364876 CAGGATGAGGAATGGGAGGAAGG + Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
914375862 1:147073055-147073077 CTGTATTAGGATTGGGAGGGAGG + Intergenic
914453139 1:147811137-147811159 CACTATAAGGAGGGGTAGGCAGG + Intergenic
914763380 1:150617159-150617181 CAATTTGAGGAGGTGGAGGAAGG - Intronic
915025824 1:152828425-152828447 CAGTATTGTAAAGGGGAGGAGGG - Intergenic
915430164 1:155860175-155860197 TAGGAATGGGAGGGGGAGGAAGG - Intronic
916525238 1:165603214-165603236 CAAAAATAGTAGGGGGAGGAGGG + Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919746935 1:201014552-201014574 CGGGCTTAGGAGGGGGAGGATGG + Intronic
920146983 1:203870257-203870279 CAGTATTGGGAGGTGGAGAAGGG + Exonic
921279224 1:213549259-213549281 GAGTCTTAGGTGGTGGAGGAAGG + Intergenic
921351142 1:214236485-214236507 CAGTATTAGGTAAGGGAGCAGGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922499470 1:226085803-226085825 GAGTATTAGGATGGTGAGGAAGG + Intergenic
922680790 1:227593558-227593580 CAGTCTGAGGAGGGTCAGGAGGG + Intronic
922690136 1:227682546-227682568 CAGTCTGAGGAGGGTCAGGAGGG - Intergenic
922732856 1:227960550-227960572 CAATTTGAGGAGGGGAAGGAAGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923056253 1:230427286-230427308 CATTATTCGAAGGAGGAGGAGGG - Intergenic
923482334 1:234397209-234397231 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
924453433 1:244199230-244199252 GAGAATTAGAAGGGGCAGGAAGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1067306472 10:45069383-45069405 CAGTTGTAGGAGGTGGAGAAAGG - Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1069242222 10:66157182-66157204 GAGTAGTGGGAGGGGGACGAGGG - Intronic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070805090 10:79266215-79266237 AAGTCTTAGGAGTGGGAGGCAGG + Intronic
1072195733 10:93116027-93116049 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073597706 10:104817372-104817394 GAGGAGGAGGAGGGGGAGGAAGG - Intronic
1074042970 10:109810419-109810441 CAGCATTGGGAGGCTGAGGAGGG + Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075904154 10:126065939-126065961 CAGCATTAGGAAGAGGATGAAGG + Intronic
1075905318 10:126076078-126076100 GACTATTAGATGGGGGAGGATGG - Intronic
1076240000 10:128897715-128897737 CAGAATCAGGTGGGGAAGGAAGG - Intergenic
1077332156 11:1988496-1988518 CTGCATTGGGAGGGTGAGGAGGG + Intergenic
1077398677 11:2341181-2341203 CAGTCGTAGGAGGTGGAGGAGGG - Intergenic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079196453 11:18331763-18331785 AAGTATTAGGAAGGGGAGTACGG - Intronic
1079505055 11:21143955-21143977 CAGTAACAGGAGGTGAAGGAAGG + Intronic
1079642831 11:22828643-22828665 TAGTATGAGGATGGGGGGGAGGG + Intronic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1079904364 11:26226581-26226603 CAGTATTAAGTAGGGGAGAAGGG - Intergenic
1080009694 11:27445550-27445572 CTGTATTCGTTGGGGGAGGAGGG - Intronic
1080032724 11:27678927-27678949 TCGTTTTAGGAGGGTGAGGAAGG - Intronic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080532283 11:33188733-33188755 CAGTATTAGGTGGGCAAGCATGG + Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1085346504 11:75771477-75771499 CAGGAATAGGAGTGGGATGATGG + Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1086046093 11:82533782-82533804 AGGGATTAGGTGGGGGAGGAAGG - Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087927024 11:103930377-103930399 TAATATTAGGTGTGGGAGGAAGG + Intronic
1088042368 11:105402844-105402866 CATTTTTAGGAGGGGGTGCAGGG + Intergenic
1088157998 11:106832448-106832470 TAGTATTAGGAGGTGTAAGATGG + Intronic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088616012 11:111628918-111628940 AAGTATTAGGAGTAGGAGAAGGG + Intronic
1089044512 11:115488372-115488394 CATTATTGGGAGGGGGAGGAGGG - Intronic
1089214685 11:116828637-116828659 CAGCGTTAGGAGGGAGAGGGAGG + Intergenic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090486059 11:127113051-127113073 CAGCCTTTGGAAGGGGAGGATGG - Intergenic
1090502966 11:127279720-127279742 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1202815137 11_KI270721v1_random:43672-43694 CTGCATTGGGAGGGTGAGGAGGG + Intergenic
1091683287 12:2542007-2542029 CAGTCTCAGGATGGGAAGGAAGG + Intronic
1093271768 12:17071572-17071594 GAGTAATAGGAGGAGGAGAAGGG - Intergenic
1094769524 12:33638061-33638083 CAATAGTATGAAGGGGAGGATGG + Intergenic
1095947813 12:47763743-47763765 CAGTGATGGGAGGGAGAGGAGGG + Intronic
1096793892 12:54061974-54061996 GAGGAAGAGGAGGGGGAGGAGGG - Intergenic
1097098110 12:56566094-56566116 CATTAAAAGGAGGGTGAGGATGG - Intronic
1098260532 12:68665488-68665510 CAGTCTTGGGATGGGGAGAAGGG + Exonic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098905687 12:76159908-76159930 TAGTAGGAGGAGGGGGATGAAGG - Intergenic
1100839350 12:98596433-98596455 AAATATTAGGAGGGAGAGGAAGG + Intronic
1101706528 12:107225725-107225747 CGGGAGGAGGAGGGGGAGGAAGG + Intergenic
1102230235 12:111257216-111257238 AAGAAGTGGGAGGGGGAGGAAGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103851864 12:123938602-123938624 CAGCGTTAGGAGGAGTAGGATGG - Intronic
1106271628 13:28159774-28159796 GAGTAGGAGGAGGGTGAGGAAGG + Intronic
1106354903 13:28972181-28972203 CTGTATTTGGAAGGTGAGGAGGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108409998 13:50135840-50135862 CATTATTGGTAGGGGCAGGAGGG + Intronic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111939139 13:94590786-94590808 AAGTATTAGGGGGGCGAGGGCGG + Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113755015 13:112804462-112804484 CAGGAAAAGGAGGGGAAGGAGGG - Intronic
1113916745 13:113878444-113878466 CAGTATTGGGAGGACGAGGTGGG - Intergenic
1118151995 14:63199631-63199653 CAGTCTTTGGCTGGGGAGGAGGG - Intergenic
1118628768 14:67683803-67683825 AAATATTAGTAGGGAGAGGAGGG - Intronic
1119004410 14:70910145-70910167 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1120345695 14:83286919-83286941 GAGTAGTTGGAGGGGGAGGAGGG + Intergenic
1120618913 14:86738883-86738905 CAGTATTGGGAGGGCTGGGAAGG + Intergenic
1120782914 14:88502103-88502125 CACTACTAGGATGGGTAGGAAGG + Intronic
1122062362 14:99144542-99144564 CAGTATTGGGAGGGTCTGGAAGG - Intergenic
1122115972 14:99527436-99527458 CAGTCTCAGGACGGGGAGAAGGG + Intronic
1122316456 14:100828396-100828418 GAAAAATAGGAGGGGGAGGAGGG - Intergenic
1122622202 14:103065791-103065813 CAGCATTGGGAAGGGGAGGGAGG - Intergenic
1123392896 15:19895234-19895256 AAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1126339841 15:47627178-47627200 AAGTAGGAGGAGTGGGAGGAAGG + Intronic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129561397 15:76574576-76574598 CAGAATTAGGAAGGGGGAGAAGG + Intronic
1129927935 15:79382765-79382787 CAGGATGAGGAGTGGCAGGAAGG - Intronic
1130721021 15:86386087-86386109 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1131719502 15:95152134-95152156 GGGGATAAGGAGGGGGAGGATGG - Intergenic
1133011414 16:2914042-2914064 GAGTGATAGGAGCGGGAGGAGGG - Intronic
1133742293 16:8660818-8660840 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1136542715 16:30937304-30937326 CAGCAAGGGGAGGGGGAGGAGGG - Intronic
1138325532 16:56163287-56163309 AAGTGTTAGGAAGGGGAGGGAGG - Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139247257 16:65457183-65457205 CAGGAGTGGGAGGGAGAGGAAGG - Intergenic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141644064 16:85358100-85358122 CGGGAGTGGGAGGGGGAGGACGG - Intronic
1142761614 17:2045425-2045447 CAGTAGTAGGTGGAGGAGAAGGG + Intergenic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143152178 17:4814555-4814577 CAGCATTAGGAGGAGAAGGGGGG + Intronic
1143153569 17:4822001-4822023 CATTATTGGAAGGGGGATGAGGG + Intronic
1143223631 17:5282286-5282308 CAGGATGAGGAGGCGGAGGTCGG + Exonic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143300127 17:5902719-5902741 CAGTATTAGGTGGAGGAGTGTGG + Intronic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1146017499 17:29245638-29245660 CAGCAGTAGGAAGGGGAAGAAGG - Intergenic
1146106248 17:30039847-30039869 CAGTTGTAGGAGGTGGAGAAGGG - Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146471732 17:33130289-33130311 GAAGATGAGGAGGGGGAGGAAGG - Intronic
1147149879 17:38508614-38508636 CCCTATTAGGAGGGGCAGGAGGG + Intronic
1147162067 17:38574118-38574140 CAGCTGTAGGAGGCGGAGGAGGG - Intronic
1147182886 17:38697920-38697942 AAGTGTTTGGTGGGGGAGGAAGG - Intergenic
1148493738 17:48039516-48039538 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1149438850 17:56657723-56657745 CATTCTTAGGAGAGGGAGTAAGG + Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1150621047 17:66807892-66807914 CTGCAGTAGGAGGGAGAGGAAGG + Exonic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151383903 17:73743714-73743736 GAGGAGGAGGAGGGGGAGGAAGG - Intergenic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152211772 17:79006243-79006265 CGGGCTTTGGAGGGGGAGGAGGG - Intronic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153891133 18:9516579-9516601 CAATATTAGGAGGGGAAACAGGG - Intronic
1154501240 18:14998971-14998993 CCATAGTAGGAGCGGGAGGACGG + Intergenic
1156016624 18:32553837-32553859 CAGGATTAGGAGGTCAAGGAGGG - Intergenic
1156526897 18:37776272-37776294 CAGCATTTGGTGGGAGAGGACGG + Intergenic
1157181942 18:45505936-45505958 CAGAACTAGGGTGGGGAGGAAGG + Intronic
1157238003 18:45982038-45982060 CCATAATAGTAGGGGGAGGAAGG + Intergenic
1157393937 18:47326256-47326278 CAGTCTTAGGAGGGTGAGTCTGG + Intergenic
1157544167 18:48536289-48536311 CAGCATTAGGTGGGGCAGCAGGG + Intergenic
1158239218 18:55358359-55358381 TAGTAGTATGAGGAGGAGGATGG + Intronic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160946260 19:1645348-1645370 CAGGATTTGGTGGGGGAGGTTGG - Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1161556827 19:4947745-4947767 CAATATTGGGAGGCCGAGGAGGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1163929304 19:20373870-20373892 CAGATGTAGGAGGTGGAGGAGGG - Intergenic
1164104763 19:22099833-22099855 CAGCATTAGGAGGCCGAGGCGGG + Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166925339 19:46263165-46263187 GAGCGTTTGGAGGGGGAGGATGG + Intergenic
1167015951 19:46841361-46841383 CAGTAGCTGGAGGCGGAGGAGGG - Intronic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167600819 19:50453864-50453886 CGGCATTTGGAGGGCGAGGAGGG + Intronic
1167686549 19:50960127-50960149 GAGGATGGGGAGGGGGAGGAGGG + Intronic
1167906882 19:52668540-52668562 CAGCTGTAGGAGGTGGAGGAGGG - Intronic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
925034242 2:673741-673763 GAGGAGGAGGAGGGGGAGGATGG + Intronic
925395500 2:3530443-3530465 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395577 2:3531103-3531125 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395582 2:3531137-3531159 TAGTAGTAGGATGGGGAAGAAGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926741816 2:16117607-16117629 AAATATTAGGACTGGGAGGAAGG - Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927474441 2:23401679-23401701 AAGTAGTGGGAGGGGCAGGAAGG + Intronic
928849567 2:35728763-35728785 TAGTATTAGGAAGTAGAGGAAGG + Intergenic
929277364 2:40040968-40040990 AAGTGTTGGGAGGGGGATGAGGG - Intergenic
929379969 2:41337937-41337959 CAGAATAAGGAAGGGAAGGAAGG + Intergenic
930277339 2:49327918-49327940 CATTGTTAGGGGTGGGAGGAAGG + Intergenic
930792174 2:55345307-55345329 CAGTATTAGGATAAGAAGGAGGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932259712 2:70317043-70317065 CAGTAATAAGAGGGGGAGAAAGG - Intergenic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932624111 2:73284404-73284426 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
933024937 2:77244582-77244604 AAGTATCAGGAGGGGGTGGAGGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934962318 2:98687543-98687565 GAATATTAGGAGGGGGAAGGTGG - Intronic
935406012 2:102709383-102709405 CAATACTAGGAGGAGGAGGCAGG + Exonic
936427867 2:112435267-112435289 CATTATTAGCAAGGAGAGGAGGG - Intergenic
936607500 2:113972957-113972979 CAGTATTATGAGTGGGAGCAGGG + Intergenic
937057255 2:118949477-118949499 CAGTTGTAGGAGGTAGAGGAGGG + Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
938201907 2:129379161-129379183 CAGTATCAGGACTGGAAGGAGGG + Intergenic
938500402 2:131829139-131829161 CCATAGTAGGAGCGGGAGGACGG + Intergenic
938873715 2:135510564-135510586 CAGGATTTGGAGTGGGAAGAAGG - Intronic
939113863 2:138038786-138038808 CAGAATTAGAAGGGGGAAGTGGG - Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
941033660 2:160541918-160541940 CAGCATTAGAATGTGGAGGAGGG - Intergenic
941101802 2:161304825-161304847 CAGTAACAGAAGGGAGAGGAAGG - Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
942306393 2:174611499-174611521 TGGTATCAGGAGGAGGAGGAGGG + Intronic
942499821 2:176577883-176577905 CTGTAGTATCAGGGGGAGGAGGG - Intergenic
942800734 2:179872595-179872617 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946492227 2:220159960-220159982 GAGGAGTAGGAGGGGGAGGAGGG - Intergenic
947951997 2:234156205-234156227 AAGAAAGAGGAGGGGGAGGAGGG - Intergenic
947978521 2:234387949-234387971 CTGTATTAGGAGGGTGTGTATGG - Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948388755 2:237597642-237597664 AAGTTTTGGGAGGAGGAGGAGGG - Intronic
948806381 2:240455086-240455108 CAGGATCGGGAGGGGGAAGATGG + Intronic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168747925 20:259988-260010 GAGTATAAGGAGGGAGAGAAAGG + Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169428262 20:5512797-5512819 CAGTATTGGGAGAGGCAGCAGGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169683912 20:8248806-8248828 GAGTATTAGTAGGTGAAGGAAGG + Intronic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170708105 20:18764208-18764230 CAGCTTTGGGAGGTGGAGGAAGG + Intergenic
1172134530 20:32678081-32678103 CAGTCTTAGAAGGGTGTGGAGGG - Intergenic
1172733882 20:37111206-37111228 CAAGAATAGGAGGGGGAGGCTGG + Intronic
1173751801 20:45482274-45482296 GAGTATGGAGAGGGGGAGGATGG - Intergenic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174521281 20:51132624-51132646 CGGGAATTGGAGGGGGAGGAGGG - Intergenic
1174639341 20:52029783-52029805 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1176374382 21:6079944-6079966 CATTATTAGCAAGGAGAGGAGGG + Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1177967009 21:27740259-27740281 CAGTGGTAAGAGGGGGAGAAGGG + Intergenic
1178213927 21:30571893-30571915 CAGAATTAGCAGGGGGACAAAGG + Intergenic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178837097 21:36108011-36108033 CAGCCATAGGAGGTGGAGGAGGG - Intergenic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179265750 21:39801419-39801441 CAGTCTTAGGATGGAAAGGAAGG - Exonic
1179749094 21:43458301-43458323 CATTATTAGCAAGGAGAGGAGGG - Intergenic
1180209801 21:46288052-46288074 GAGCATTAGGAGGGGAAGGGGGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1181955822 22:26587264-26587286 CAGTATTAGGAGGGGGTGAAAGG - Intronic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183646295 22:39128923-39128945 CAGTAATGGGATGGGAAGGATGG + Intronic
1183922054 22:41177429-41177451 CAGTCTGAGGAGGGGTTGGAGGG - Exonic
1184020036 22:41814622-41814644 CAGGGCTAGGAGGGGCAGGAAGG + Intronic
1184121186 22:42451644-42451666 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1184274306 22:43401415-43401437 CAGGAGTAGGAGGGTGAGGTGGG + Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949485320 3:4532474-4532496 CAGGATTAGGAGGCTGAGGGGGG - Intronic
951293423 3:20902360-20902382 CAGTCTTAGGAGTGTGAGAATGG + Intergenic
951502961 3:23410961-23410983 TAGTTTGAGGAGGGAGAGGAGGG - Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952509545 3:34039334-34039356 CATTATTAGCAGGGAAAGGATGG - Intergenic
953016299 3:39080099-39080121 AATTATTTGGAGGTGGAGGAGGG + Intronic
953365425 3:42340467-42340489 GAGGAGGAGGAGGGGGAGGAGGG + Intergenic
953405842 3:42659391-42659413 GAGGAGGAGGAGGGGGAGGAGGG + Exonic
954089709 3:48274457-48274479 GTGTATTAGGAGGGGGACTAGGG - Intronic
954594743 3:51814708-51814730 CTGCTTTAGGAGGAGGAGGAGGG - Intergenic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955871995 3:63449092-63449114 CAGTATTGGGAGAGGAAAGAAGG + Intronic
955973907 3:64462800-64462822 CAGTATTAGAGGGAGGAAGAGGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957170883 3:76735428-76735450 GATTATTTAGAGGGGGAGGAAGG + Intronic
957535000 3:81490748-81490770 CTGTATTAGGTGGTGAAGGAAGG + Intronic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
957592570 3:82219406-82219428 GACTACTAGAAGGGGGAGGAAGG - Intergenic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960858409 3:122126567-122126589 GAGAATTAGTAGTGGGAGGATGG + Intergenic
961609986 3:128129011-128129033 TGACATTAGGAGGGGGAGGAGGG - Intronic
961961012 3:130855109-130855131 CAGGATTAGAAGGGTGAAGATGG - Intronic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
965382484 3:168007069-168007091 CAGTATTAGAAGGGATAAGATGG + Intergenic
966724496 3:183097495-183097517 GAGGATGAGGAGGGCGAGGACGG - Intronic
966908491 3:184544536-184544558 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968555672 4:1245419-1245441 CTGTGTTGGGAAGGGGAGGAAGG - Intronic
968889292 4:3359184-3359206 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969454772 4:7294839-7294861 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970362588 4:15324604-15324626 AAGTAGTTGTAGGGGGAGGATGG - Intergenic
970386472 4:15561893-15561915 TAGTAGTAGGAGGGAGAGCAGGG - Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971627849 4:28946270-28946292 GACTATTAGAAGGGGGAGGGAGG + Intergenic
971769824 4:30882098-30882120 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
972097410 4:35364927-35364949 CAGTATTAGGAGAAGTAGCAGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
973887943 4:55341761-55341783 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
974125980 4:57696296-57696318 GAGTATGGGGTGGGGGAGGAGGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976561487 4:86506615-86506637 CACTGATAGGAAGGGGAGGAAGG + Intronic
976633486 4:87263947-87263969 CAGTATCAGGAGGCAGAGGCAGG - Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985573903 5:664935-664957 CGGTAGGAGGAGGGGCAGGAGGG + Exonic
986707796 5:10465909-10465931 GAGTCTTAGGAGGGGTAGGCAGG - Intronic
987033350 5:13996214-13996236 TAGTATTAGGAGGTGGGGCATGG - Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
991525143 5:67547986-67548008 CACTTTTAGAAGGGGGAGCAGGG + Intergenic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993055099 5:82971797-82971819 CAGCCATAGGAGGTGGAGGAGGG + Intergenic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993305598 5:86271576-86271598 CAGGATGAGGAATGGGAGGAAGG + Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
996101176 5:119447399-119447421 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997475924 5:134142433-134142455 CAGAAGTAGGAGGGGGTGGGTGG + Intronic
997756140 5:136400994-136401016 CAGGATTTGGAGGGGGTGGGGGG + Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
999145352 5:149389610-149389632 CAGCACTGGGATGGGGAGGAGGG + Intronic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
999473254 5:151874925-151874947 GAGCATGAGGAGGGGAAGGAAGG + Intronic
999733194 5:154491936-154491958 CAGAATTGGGTGGGGAAGGAGGG + Intergenic
1000105504 5:158055248-158055270 AAGCATTAGGAGGGGGTGGGAGG + Intergenic
1001483487 5:172104139-172104161 CAGTGGCAGGAAGGGGAGGAAGG - Intronic
1001763891 5:174229758-174229780 CAGTATGAGGAAGGAGGGGAAGG - Intronic
1002061037 5:176626290-176626312 CAGGATTAGGGGGGCGGGGATGG + Intronic
1002102365 5:176863807-176863829 GAGGAGGAGGAGGGGGAGGAGGG - Intronic
1003532216 6:6947137-6947159 GAGTAGTCTGAGGGGGAGGAAGG - Intergenic
1004407143 6:15343601-15343623 GTGTATTTGGAGGGAGAGGAAGG + Intronic
1004637822 6:17485869-17485891 GAGGATGAGGAGGGGAAGGATGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1006387053 6:33737123-33737145 GAGGAGTGGGAGGGGGAGGAGGG - Intronic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007811897 6:44492155-44492177 CATTACTACGAGGGCGAGGAAGG - Intergenic
1008026181 6:46638708-46638730 CAGTAGTAGGGGGTGGAGGGGGG - Intronic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008290831 6:49713779-49713801 CCGTACTAGGAGGAGGAGGGAGG + Intergenic
1009440914 6:63677058-63677080 CAGTTTTTTGAGGGGGAGGGAGG + Intronic
1010147520 6:72688081-72688103 CAGTATTGGGAGGCCGAGGCAGG - Intronic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1013415275 6:109919237-109919259 CAGTCTTAGGAGGGGATGGGAGG - Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014072231 6:117196062-117196084 CAGTAATAGGAAGGAGAAGAAGG - Intergenic
1014179303 6:118367364-118367386 CAGTATTAGGAGCTGGATGATGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016733547 6:147451805-147451827 TAGCATGAGGAGGGGGAGTAAGG + Intergenic
1017566015 6:155687627-155687649 AAATATTGGGAGGGGGAGAAGGG + Intergenic
1017688819 6:156942741-156942763 AAGCAATAGGAGGAGGAGGATGG - Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019531747 7:1506688-1506710 GAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1020476389 7:8600004-8600026 CAGTATTAGTAGTTGAAGGAGGG + Intronic
1021602988 7:22382865-22382887 CAGAATGATGAGGGAGAGGAAGG - Intergenic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022494237 7:30843308-30843330 CAGCATTTGGAGGAGGAGGGTGG + Intronic
1022524616 7:31029009-31029031 CAGTATTGGGAGGATGAGGTGGG - Intergenic
1023038093 7:36150406-36150428 AAGGTTTAGGAGGGGGATGAAGG - Intergenic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023951183 7:44847678-44847700 CCGTCTTAGAAGGAGGAGGACGG - Intronic
1027199622 7:76055243-76055265 TAGTATGAGGATGGGGAAGAGGG + Intronic
1027753828 7:82185521-82185543 GAGGAGGAGGAGGGGGAGGAAGG + Intronic
1028279406 7:88903098-88903120 GACTATTAGAGGGGGGAGGAAGG - Intronic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1029983694 7:104902428-104902450 GAGGAGGAGGAGGGGGAGGAGGG + Intronic
1030154790 7:106443323-106443345 CAGTATGAGGAAGGTGAGAAAGG + Intergenic
1031024451 7:116664839-116664861 CTGTATTTGCAAGGGGAGGAAGG - Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031970405 7:128060999-128061021 CAGAATTGGGAGGTGGAGCAGGG + Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032505476 7:132431320-132431342 CAGGATTGGGAGGGGGAGAGGGG - Intronic
1033551407 7:142451501-142451523 GAGTCTTGGGTGGGGGAGGAGGG - Intergenic
1033553672 7:142470066-142470088 GAGTCTTGGGTGGGGGAGGAGGG - Intergenic
1033555877 7:142488350-142488372 GAGTCTTGGGTGGGGGAGGAGGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034255925 7:149724671-149724693 CAAGATCAGGATGGGGAGGAGGG - Exonic
1034449266 7:151128714-151128736 GAGTATGGGGAGGGGGTGGAGGG + Intronic
1035910655 8:3562165-3562187 CAGTAGTAGGTGGGGAAAGATGG + Intronic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036448740 8:8846324-8846346 GAGGAGTAGGAGGGGGAGGAGGG + Intronic
1036660233 8:10703064-10703086 GAGTATTGGGAGGGAGAGGCAGG - Intronic
1037480319 8:19299061-19299083 AAGAATTAGGTAGGGGAGGAAGG + Intergenic
1037484329 8:19333193-19333215 CAGTATCAGGTGGGAGAGTAGGG + Intronic
1037782838 8:21882491-21882513 AAGTGTTTGGAGGAGGAGGAGGG - Intergenic
1038284960 8:26198484-26198506 AAGGAGGAGGAGGGGGAGGAGGG - Intergenic
1038709907 8:29933893-29933915 GAGTATTAGGTGGGTGGGGAAGG - Intergenic
1039944611 8:42118674-42118696 CTGTAGTGGGAGGGGGTGGACGG - Intergenic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1043108696 8:76150243-76150265 CAGTATTAGAAGGCTGAGGCAGG - Intergenic
1043283266 8:78496397-78496419 CAGTATTTGGAGAGGAGGGAAGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1047444844 8:124910487-124910509 CAGTTGTAGGAGGTGGAGGAGGG - Intergenic
1047505444 8:125475999-125476021 GATTACTAGTAGGGGGAGGATGG - Intergenic
1048102422 8:131368224-131368246 GAGTATGAGGAAGGGGAAGATGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1049122022 8:140747649-140747671 GAGGAAGAGGAGGGGGAGGAAGG + Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049505766 8:142996651-142996673 TAGTACTGGGAGGGGGAAGAGGG - Intergenic
1049695975 8:143984496-143984518 CAGTAGGAGGAGGGGGCTGAAGG + Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1049937131 9:510056-510078 CACTTTTAGGAGGGCAAGGAGGG - Intronic
1050241250 9:3637999-3638021 AAGAAGGAGGAGGGGGAGGAAGG - Intergenic
1052292267 9:26856058-26856080 GAGTTTTAGGAGGCCGAGGAGGG - Intronic
1055605485 9:77966151-77966173 CAGTGTTTGGAGGGGGAGATAGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056343767 9:85668349-85668371 AAGTATCAGGAGGGAGAGGTGGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1056967955 9:91179893-91179915 CAGAATTATTTGGGGGAGGAGGG + Intergenic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1061661340 9:132132314-132132336 CAGTTTCAGGAGGGGCAGGGAGG + Intergenic
1062525140 9:136975180-136975202 CAGTCCTAGCCGGGGGAGGAGGG + Intergenic
1062578968 9:137221407-137221429 CAGTCCTGGGAGGAGGAGGAAGG + Intronic
1062717216 9:138017259-138017281 CAGAGTTAGGAGTGGAAGGAAGG - Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1186983761 X:14987759-14987781 CACTATCAGTAGGTGGAGGATGG + Intergenic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188599301 X:31941702-31941724 GACTACTAGAAGGGGGAGGAAGG - Intronic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1190322619 X:49187573-49187595 CAGTAGTGGGAGGGTGAGCAGGG + Intergenic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1192847999 X:74925493-74925515 GAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1194284079 X:91988293-91988315 CAGTATGAGGAGGAGAAGGGAGG - Intronic
1194904156 X:99553110-99553132 CAAGAGTAGGAGGGAGAGGAAGG - Intergenic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195650008 X:107274386-107274408 CAGCATTGAGAGTGGGAGGAAGG - Intergenic
1195668374 X:107449984-107450006 GAGGAAGAGGAGGGGGAGGAAGG + Intergenic
1195684530 X:107573543-107573565 CATTATTAGGAAGGGGTAGAAGG - Intronic
1195977130 X:110539464-110539486 CAGCATTGTGAGTGGGAGGAGGG - Intergenic
1198020760 X:132655671-132655693 CAGTATAACGAAGGGGATGAAGG + Intronic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198228272 X:134666506-134666528 CAGTCTTAGGAGGGTGAACATGG + Intronic
1198277214 X:135106405-135106427 GACTACTAGAAGGGGGAGGAGGG - Intergenic
1198301559 X:135338852-135338874 AAGGATTAGGAGGGAGAGTAGGG - Intronic
1199879108 X:151958847-151958869 CAGTATTAGGCAGGGGCAGAGGG - Intronic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1201893255 Y:18966130-18966152 TAATCCTAGGAGGGGGAGGAGGG + Intergenic