ID: 1085431631

View in Genome Browser
Species Human (GRCh38)
Location 11:76455586-76455608
Sequence CCTTTCAACCACATTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085431631_1085431634 13 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431634 11:76455622-76455644 GAGAAGATTGAGCACAAAGGAGG 0: 1
1: 0
2: 1
3: 25
4: 269
1085431631_1085431633 10 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431633 11:76455619-76455641 GCTGAGAAGATTGAGCACAAAGG 0: 1
1: 0
2: 3
3: 14
4: 219
1085431631_1085431638 26 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431638 11:76455635-76455657 ACAAAGGAGGGGGAAACAAAAGG 0: 1
1: 0
2: 3
3: 71
4: 717
1085431631_1085431635 14 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431635 11:76455623-76455645 AGAAGATTGAGCACAAAGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 350
1085431631_1085431637 16 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431637 11:76455625-76455647 AAGATTGAGCACAAAGGAGGGGG 0: 1
1: 0
2: 2
3: 26
4: 279
1085431631_1085431636 15 Left 1085431631 11:76455586-76455608 CCTGAAGGAATGTGGTTGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1085431636 11:76455624-76455646 GAAGATTGAGCACAAAGGAGGGG 0: 1
1: 0
2: 0
3: 30
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085431631 Original CRISPR CCTTTCAACCACATTCCTTC AGG (reversed) Intronic
900762855 1:4484472-4484494 CTTTTCAGCCAGTTTCCTTCAGG - Intergenic
902879721 1:19363522-19363544 CTTTTCAACCACAGGACTTCTGG + Intronic
903468441 1:23568382-23568404 CCGAACAGCCACATTCCTTCGGG - Intergenic
904935694 1:34128131-34128153 CCTTCCTCCCACATTCCCTCTGG + Intronic
905825606 1:41023936-41023958 TCTTGCCACCACATTCCGTCAGG - Intergenic
906117628 1:43366830-43366852 CCTTCCCCCGACATTCCTTCAGG - Intronic
909391634 1:75127309-75127331 CCTATCCAACACATTCCTACTGG + Intergenic
909661850 1:78092179-78092201 CCTTTCAATTACATTCCCTTGGG - Intronic
909675035 1:78229506-78229528 CCTTTCAACCAAATGGCTGCAGG + Intergenic
911397279 1:97326335-97326357 ACTCTCAACCAGATTCTTTCAGG - Intronic
917716233 1:177740817-177740839 CCCTTCACCCACATACCCTCTGG + Intergenic
923799826 1:237197643-237197665 CCTTCCACCCTCATTCCTACAGG - Intronic
1064397389 10:14992744-14992766 CCTTTTACCCACAGTCCTCCAGG + Intergenic
1065187404 10:23181881-23181903 ACTTTCCACAACAATCCTTCAGG + Intergenic
1066770561 10:38841969-38841991 CCTTTCAATTACATTCCATTCGG - Intergenic
1070261813 10:74863797-74863819 TCTTTCAACCACATTTAGTCTGG + Intronic
1071290134 10:84182668-84182690 CATCTCTACCACATTCATTCTGG + Intronic
1071292647 10:84198537-84198559 ACTTTCTACCTCTTTCCTTCTGG + Intronic
1073306770 10:102509052-102509074 CCTTTCACCCAGGTTCCTCCAGG + Intronic
1075637756 10:124041774-124041796 CCTGTCAACCTCATGCCTTTGGG - Intronic
1076504527 10:130963077-130963099 CCTGTCATCCACAAGCCTTCAGG + Intergenic
1077911209 11:6572324-6572346 CCTTTCAAACATATCCCTTGTGG - Intronic
1079753275 11:24225219-24225241 CCTTTCAAGCTCATTCTGTCAGG - Intergenic
1081874923 11:46401959-46401981 CCTGTCCCCCACATTCCTGCAGG + Intronic
1084261279 11:67980402-67980424 CCTTACACCCACAGTCCTCCAGG + Intergenic
1085431631 11:76455586-76455608 CCTTTCAACCACATTCCTTCAGG - Intronic
1087993976 11:104780736-104780758 CCTTTCAACCAATTGCCTTCAGG - Intergenic
1088176922 11:107063604-107063626 CATTTTAACCACATTTCTACTGG - Intergenic
1089016691 11:115171167-115171189 ACTGGCAGCCACATTCCTTCAGG - Exonic
1092025350 12:5234938-5234960 CCTTTCATCCTCCTTCCTTCAGG - Intergenic
1093400174 12:18736643-18736665 CCTTCCAACTTCATGCCTTCAGG - Intronic
1096475838 12:51908205-51908227 CCTTGCCACGACCTTCCTTCAGG + Intronic
1097625043 12:61989657-61989679 CCTTTGAACCACATCTATTCTGG - Intronic
1099247890 12:80215789-80215811 CTCTTCAGCCACATTGCTTCTGG - Intronic
1101023749 12:100579898-100579920 TCTCTCCACAACATTCCTTCAGG - Intronic
1101946389 12:109140354-109140376 CCTTTCAAAATCATTCCTTGAGG + Intronic
1102576270 12:113858040-113858062 CTCTGCAGCCACATTCCTTCTGG + Intronic
1104246083 12:127043010-127043032 AATTACAACCACAATCCTTCGGG + Intergenic
1106847132 13:33748493-33748515 TCCTGCAACCTCATTCCTTCTGG - Intergenic
1108005509 13:45942071-45942093 CCTTTCACCCACTTGCCTTGTGG - Intergenic
1110071299 13:71182377-71182399 ACTTTCTAACACATGCCTTCTGG - Intergenic
1110148547 13:72222917-72222939 CATTTTCACCACTTTCCTTCAGG + Intergenic
1111491471 13:88981713-88981735 CCCTCCAACCCCATTCTTTCCGG - Intergenic
1114223792 14:20720525-20720547 CCTTTGAAACATTTTCCTTCAGG - Intergenic
1117535552 14:56699343-56699365 CCATTCTTCCACATTCCTTATGG + Intronic
1118737628 14:68713407-68713429 CCTTTCTTCCCCATTTCTTCGGG - Intronic
1121514725 14:94542030-94542052 TCTTTCAACCACAGTGCTTTGGG + Intergenic
1124219644 15:27838412-27838434 CATTTCAACCACTTTCTTTCTGG - Intronic
1125695953 15:41637538-41637560 GCTTTTCACCACATTCCTTCTGG - Intronic
1126578652 15:50222065-50222087 CCATTCAACCACAGTCATTTAGG - Intronic
1126650695 15:50918860-50918882 TTTTTCAACCACATCCCTTTTGG + Intronic
1127309547 15:57740103-57740125 CTTCTCAACCACATTCCTAGGGG - Intronic
1127453293 15:59136920-59136942 CCTCTCTGCCACCTTCCTTCAGG - Exonic
1127531044 15:59843807-59843829 TCTTTAATCCACATCCCTTCTGG - Intergenic
1128292860 15:66491760-66491782 TCTTCCAACCACCTTCCTTGTGG + Exonic
1131752022 15:95519982-95520004 TCTTGCAACCAGAGTCCTTCGGG + Intergenic
1137077846 16:35997469-35997491 CTTTTCCACCACAGTCCTCCAGG - Intergenic
1138680451 16:58680167-58680189 CCTTACAACCACATGCCTCAGGG + Exonic
1141728618 16:85807562-85807584 CCTATGAACCACTTTTCTTCTGG + Intergenic
1143931693 17:10435540-10435562 CCTTTCAATCACATTTGCTCGGG + Intergenic
1145348394 17:22056574-22056596 CCCTACAACCACATACCTTGGGG + Intergenic
1145704431 17:26858975-26858997 CCTTTCAAGACCATTCCTTTTGG - Intergenic
1146599967 17:34205659-34205681 CATTTCCACCACCTTCCTCCTGG + Intergenic
1147608966 17:41790305-41790327 CCATTCAAACACAGTCCTTAGGG + Intergenic
1149680640 17:58504730-58504752 CCCTCCTGCCACATTCCTTCTGG + Intronic
1150863199 17:68822558-68822580 CCTATCATCCACATTGCTCCTGG - Intergenic
1151957073 17:77385795-77385817 CCTTTGGCCCACATTCCTTGTGG - Intronic
1154099634 18:11459024-11459046 CCTTTAATCCACATACCTTTTGG - Intergenic
1156570474 18:38246507-38246529 CCTTTCACCCTCTTTCCTGCTGG - Intergenic
1162426066 19:10596694-10596716 CCCTTCAACCACATGCTTTCCGG - Intergenic
1164680308 19:30130206-30130228 CAATTCAACCATCTTCCTTCAGG - Intergenic
1165640886 19:37385293-37385315 CCTTTCAACCAGATGTCGTCAGG + Intronic
924971769 2:134666-134688 CCTCTCAACCAAAATCTTTCAGG - Intergenic
928118223 2:28563362-28563384 CCTGTCACCCACACTCCCTCTGG - Intronic
929200058 2:39225719-39225741 CCTTTCTACCACAATGCATCTGG - Intronic
930521071 2:52468256-52468278 CATGGCAATCACATTCCTTCTGG + Intergenic
932836997 2:75047153-75047175 CTGTTCAACCAAATTCCTTTAGG + Exonic
934109569 2:88729519-88729541 CCTTTCCACCACATTCCTTGTGG + Intronic
935390912 2:102551863-102551885 CCTTCCAAGCACATTCTTTTTGG - Intergenic
941003132 2:160221879-160221901 CCCTTCACCCACATTCCACCAGG - Intronic
945080625 2:206084724-206084746 CCTTTCATCCCGATTCCTTTGGG - Intronic
947653206 2:231804803-231804825 ACTTTAAAACACATTCCCTCAGG + Intronic
948116302 2:235495956-235495978 GCTTTCAGGCACATTCCTGCCGG - Intronic
1169735562 20:8833933-8833955 CTTTACAACCACATTTCTTGTGG + Intronic
1172368424 20:34367550-34367572 CCTTCCAAACACAGTGCTTCTGG - Intronic
1181528617 22:23503412-23503434 CCTGTCACCCACATCCCTCCAGG + Intergenic
1182474689 22:30570356-30570378 TCTTTGAGCCACATTCCTGCAGG - Intronic
1183252130 22:36737676-36737698 CCTTTTAACGAATTTCCTTCCGG - Intergenic
1183462112 22:37957759-37957781 CTTTTCAGCCACATTCCTGCAGG + Intronic
1184371722 22:44086561-44086583 CCCTCCAATCACCTTCCTTCTGG + Intronic
950474544 3:13207250-13207272 CCTTCCCACCAGATTCCTCCTGG + Intergenic
953486324 3:43300475-43300497 CTTTCAAAACACATTCCTTCAGG - Intronic
953841383 3:46392599-46392621 TCTTTCACCCACATTCCATTTGG - Intergenic
953891644 3:46755797-46755819 CCTCCCAACCACATCCCCTCAGG + Intronic
955207656 3:56911152-56911174 CCTCTCCACCATATTCCTTGTGG - Intronic
957210111 3:77248277-77248299 TCATGCAACCTCATTCCTTCTGG + Intronic
957718735 3:83967868-83967890 CCTTTCAAACACCATCCTGCTGG - Intergenic
958750575 3:98190049-98190071 CCTTTCTACCACATGCGTTTTGG - Intronic
959290826 3:104470704-104470726 ACTTTTAACCACTTTCCTCCTGG - Intergenic
959750808 3:109832299-109832321 GCTTTCAACTTCTTTCCTTCAGG - Intergenic
961104275 3:124227952-124227974 CCTCTCACCCTGATTCCTTCTGG + Intronic
961818744 3:129564547-129564569 CCTTTCTCCCACAATCCTCCAGG + Intronic
961852030 3:129830110-129830132 CCTTTCACCCAAATTCTTTGTGG + Intronic
963140160 3:141940344-141940366 ACTTTCATCCAAATTGCTTCAGG - Intergenic
966319118 3:178680895-178680917 GCTTTCAATGACAGTCCTTCAGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968592018 4:1464061-1464083 ACCTTCACCCACATTCCCTCGGG - Intergenic
968684474 4:1948066-1948088 CCTTAGAAATACATTCCTTCAGG - Intronic
969024505 4:4162670-4162692 CCTTACACCCACAGTCCTCCAGG + Intergenic
969793639 4:9509203-9509225 CCTTACACCCACAGTCCTCCAGG - Intergenic
969995938 4:11313316-11313338 CATTTCAATCACTTTTCTTCTGG - Intergenic
970332431 4:15001444-15001466 CCTCCCCACCACATTCATTCCGG - Intergenic
971005489 4:22370087-22370109 TCTTGCAACCTCATTCCTCCTGG + Intronic
971103081 4:23490715-23490737 AATTTCAACCACATTGCTTCAGG - Intergenic
972077340 4:35104214-35104236 CCTTATATCCACAGTCCTTCAGG - Intergenic
972570831 4:40309224-40309246 ACTTTCATACACATTCCTTCAGG - Intergenic
973795818 4:54425223-54425245 CCTTTCTCCCACATCCCTGCAGG + Intergenic
975386662 4:73767089-73767111 CCTTTCAAGGACATTCCTAAAGG - Intergenic
978788116 4:112632497-112632519 CTTTTCATCCTCACTCCTTCAGG + Intronic
979906749 4:126302824-126302846 CCTTTCTCCAAGATTCCTTCAGG + Intergenic
981567161 4:146113780-146113802 CCTTTCAAACACATGCTTGCAGG - Intergenic
981977126 4:150744380-150744402 CTTCTCTACCACCTTCCTTCAGG + Intronic
986294301 5:6424323-6424345 CCTTCCAAACGCATTCCTGCTGG - Intergenic
988866181 5:35337725-35337747 CCTTTCAACCAGTTGCCATCAGG - Intergenic
992020570 5:72619788-72619810 CCTGTCATCCCCATTCCTGCAGG - Intergenic
992096491 5:73367810-73367832 GGTTCCAACCACATTCCTGCAGG - Intergenic
995632302 5:114147518-114147540 CCTTTCATCCACTGTCCTGCAGG - Intergenic
996618894 5:125476311-125476333 CCTTCCAACCACTTTCTTCCAGG - Intergenic
997025489 5:130055730-130055752 CCTTCCCACCACAGTGCTTCCGG - Intronic
998149236 5:139747509-139747531 GCCCTCCACCACATTCCTTCCGG - Intergenic
1000554575 5:162709941-162709963 CCTTTAAAGCAAATTTCTTCTGG + Intergenic
1000908954 5:166997596-166997618 TCTTTCTGCCACATTCATTCAGG - Intergenic
1002939910 6:1706920-1706942 CCTTTAAAGCAATTTCCTTCAGG - Intronic
1006342969 6:33456737-33456759 CCTATAAACCACTTTCCTGCAGG - Exonic
1007378692 6:41472858-41472880 CCTCCCAACCAAATTCCTCCAGG - Intergenic
1008165137 6:48128099-48128121 CTTTTCAACCACGTTCATTTTGG - Intergenic
1008614520 6:53213358-53213380 CCTTTGAACCACATGCAATCTGG - Intergenic
1011470447 6:87702364-87702386 CCTTTCAAGCCGATTCCTCCCGG - Intergenic
1012611845 6:101228205-101228227 CCTTTTACCAACATTCCTCCAGG + Intergenic
1013587575 6:111593303-111593325 CATTTCAACCACATTCACTGAGG + Intronic
1017590436 6:155973515-155973537 CCTTTCATCCAGACTGCTTCTGG - Intergenic
1018405561 6:163478355-163478377 CCTTTCTACCAAAATCCTTTGGG - Intronic
1018937709 6:168284419-168284441 CCTTTGACTCACATTCCTTGAGG + Intergenic
1020152820 7:5696686-5696708 CCTTAGAACCAGGTTCCTTCAGG + Intronic
1022221251 7:28315966-28315988 CCTGCCAACCACATTTCCTCCGG + Intronic
1022503714 7:30897766-30897788 CCTCCCACCCACTTTCCTTCAGG - Intergenic
1023864299 7:44231662-44231684 CCTGTCGCCCACATTCCCTCAGG + Intronic
1024221690 7:47293756-47293778 CCTTTCAACCGCACTCCCTTCGG + Exonic
1025849349 7:65233314-65233336 TCTTGCAACCTCATTCCTCCTGG + Intergenic
1026005290 7:66595688-66595710 CATTCCAACCACATTCCCGCAGG + Intergenic
1026012766 7:66649711-66649733 CATTCCAACCACACTCCTGCAGG - Intronic
1027685019 7:81268567-81268589 CCTTACAACTACATTCTTTCAGG + Intergenic
1029078336 7:97953241-97953263 CCTTACACCCACAGTCCTCCAGG + Intergenic
1030755301 7:113280535-113280557 CCATTCAGCCACATTCCAACAGG - Intergenic
1031041836 7:116846686-116846708 CCCTCCAACCACATTTCATCTGG + Intronic
1031631309 7:124046561-124046583 CCATCCACCCATATTCCTTCTGG + Intergenic
1035415188 7:158677675-158677697 CCTTACAACCACATCCTCTCTGG + Intronic
1036605622 8:10303155-10303177 CCTGTCACCTACATGCCTTCAGG - Intronic
1037477310 8:19270327-19270349 CCTTTCAAACATTTTCCTTTTGG - Intergenic
1038263902 8:26022031-26022053 CCTTTCAAGCACATGGCTTGGGG - Intronic
1040383945 8:46900674-46900696 CCTTCCCACCACCTTCCTCCTGG - Intergenic
1040383960 8:46900725-46900747 CCTTCCCACCACCTTCCTCCAGG - Intergenic
1042147170 8:65742256-65742278 CCTTCCAACCAGATCCCATCTGG - Intronic
1044038754 8:87338857-87338879 CCTTACAACCACATTACTAAAGG - Intronic
1044389437 8:91632195-91632217 CCTTTCATCCACTTTGCTTTGGG + Intergenic
1046815504 8:118578861-118578883 CCTTTCAACCTCATTTGTTGGGG + Intronic
1047450059 8:124957101-124957123 AAGTTCAACCACATTCCTTTGGG - Intergenic
1047841551 8:128759299-128759321 ACTTTCAAACTCATTCCTTTAGG + Intergenic
1048194452 8:132320892-132320914 CTTTTCACCCACAGTCCTTAGGG + Intronic
1055903877 9:81270770-81270792 CCTTTTCACCACCGTCCTTCAGG + Intergenic
1056779267 9:89537371-89537393 CCTGGCAACCAGATTCCTCCAGG + Intergenic
1058747999 9:108010462-108010484 CCCTTAATCCACTTTCCTTCAGG + Intergenic
1058923375 9:109639482-109639504 CCTTTCAACCCCAGTCCCTCAGG + Intergenic
1058954794 9:109935878-109935900 CCTTTCTGCCACTTTCTTTCTGG + Intronic
1062032229 9:134366860-134366882 CCTTTCCACCACGTTCCGACTGG - Intronic
1203682244 Un_KI270756v1:74388-74410 CCTTTCAATTACATTCCATTCGG + Intergenic
1185909810 X:3971113-3971135 CCTTATACCCACAGTCCTTCAGG - Intergenic
1192205727 X:69094902-69094924 CCCTGCAGCCACTTTCCTTCAGG + Intergenic
1194669293 X:96710483-96710505 CCTGTCTGCCACATTCTTTCTGG + Intronic
1194897573 X:99464051-99464073 ACCTACAGCCACATTCCTTCTGG + Intergenic
1197244993 X:124158575-124158597 CCTTTCTATCACATTCCTGAAGG - Intronic
1198125403 X:133638673-133638695 CCTGTGAACCACATGCCTTGAGG - Intronic
1198234579 X:134725210-134725232 ACTGTCACCCAGATTCCTTCTGG + Intronic
1198989283 X:142492062-142492084 ACTTTCACACATATTCCTTCAGG - Intergenic
1201554968 Y:15257968-15257990 ACTTTTACCCACAGTCCTTCAGG - Intergenic
1201923866 Y:19263724-19263746 TCTTTCTACCTCATTTCTTCAGG - Intergenic
1202203058 Y:22374723-22374745 GCTTTGAAAGACATTCCTTCTGG + Intronic