ID: 1085433004

View in Genome Browser
Species Human (GRCh38)
Location 11:76472585-76472607
Sequence TTGGGCACGAAGGTTGAGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085433004 Original CRISPR TTGGGCACGAAGGTTGAGCT TGG (reversed) Exonic
900242455 1:1623549-1623571 GTGGGCACGGTGGTGGAGCTTGG + Exonic
900370034 1:2328207-2328229 CTGGGCATGAAGTTAGAGCTGGG + Intronic
901869655 1:12130518-12130540 TTTGGCACAGAGGTTCAGCTAGG - Intronic
904248727 1:29206961-29206983 TTGGCCAAGGAGGGTGAGCTGGG - Intronic
906056455 1:42921939-42921961 TTGGGCCCAAAGCCTGAGCTGGG + Intergenic
908065376 1:60397862-60397884 TTGGGCACAGTGGTTGAGGTGGG - Intergenic
915947072 1:160161104-160161126 GTGGCCAAGAAGGTGGAGCTAGG + Intronic
921115792 1:212089851-212089873 TTGGGGAAGAAGGAAGAGCTGGG - Intronic
922085508 1:222343235-222343257 ATGGGCAGGAGGGTGGAGCTGGG + Intergenic
1062771298 10:103893-103915 TTGGCCTGGAAGGTTGCGCTTGG + Intergenic
1064370905 10:14750945-14750967 GTGGGCACGATGGGGGAGCTTGG + Intronic
1066407264 10:35129557-35129579 TTGGGCCAGAAGATTGAGCTAGG + Intronic
1067731936 10:48818999-48819021 TTGGGCATGGGGGCTGAGCTGGG - Intronic
1074297226 10:112201481-112201503 TTGGGGACGAGGGTTGAGTAAGG - Intronic
1077815036 11:5678726-5678748 TTTGGCAGGGAGTTTGAGCTTGG - Intronic
1077902680 11:6502345-6502367 AAGGCCAAGAAGGTTGAGCTGGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1083893627 11:65609399-65609421 TTGGCCACAAAGGAGGAGCTTGG + Intronic
1085433004 11:76472585-76472607 TTGGGCACGAAGGTTGAGCTTGG - Exonic
1086143386 11:83523866-83523888 ATGGGCAGGAAGATGGAGCTTGG - Intronic
1086742336 11:90383286-90383308 TTGGGCACTAGAGTTGAACTAGG + Intergenic
1088460769 11:110080286-110080308 TGGGGCCAGAAGGTTGACCTAGG - Intergenic
1097188175 12:57206731-57206753 TTGGGCACTCACGTTGAGGTGGG - Exonic
1098071557 12:66681307-66681329 TAGGGCAAGAAGGTTGACCTGGG - Intronic
1102766643 12:115439320-115439342 TTGGGGACAAGGGTGGAGCTTGG + Intergenic
1112030474 13:95451895-95451917 TTGGACAAGAAGGTTGAAGTTGG - Intronic
1117602818 14:57391558-57391580 TCGGGCAGGGAGGTTGAGCCTGG + Exonic
1126520903 15:49592844-49592866 GTGGGCAGGAAGCTTGAACTGGG - Intronic
1128775017 15:70313669-70313691 TTGGGCAGGCTGGATGAGCTGGG - Intergenic
1130934773 15:88459671-88459693 TGGGTCACTAAGGATGAGCTGGG - Exonic
1131363789 15:91819850-91819872 CTGGTCAGGAAGGTTGAGCAAGG + Intergenic
1132539775 16:503312-503334 TTGTGCACGAAGGGCCAGCTGGG + Intronic
1134285063 16:12854089-12854111 TTGGGCATGCATGTTGAGCAAGG + Intergenic
1137074403 16:35944184-35944206 GTGGCCAGGAAGGTTGAACTGGG + Intergenic
1138114812 16:54351897-54351919 CTGGGCACCTAGGTTGTGCTAGG - Intergenic
1140265025 16:73413056-73413078 TTGGGCACGAAGGTGGAAATGGG + Intergenic
1142165365 16:88584129-88584151 TTGGGCACGGAGGCTGGGCGTGG + Intronic
1144026296 17:11278889-11278911 CAGGGCAGGAAGGTGGAGCTGGG + Intronic
1147205761 17:38836234-38836256 TTTGGCAAGAGGGCTGAGCTGGG - Intronic
1150654508 17:67031149-67031171 CTTTGCACGAAGGTTGTGCTGGG + Exonic
1153626249 18:7024756-7024778 TTGGGCACTGGGGCTGAGCTGGG - Intronic
1158580934 18:58682091-58682113 TTGGAAAGGCAGGTTGAGCTTGG + Intronic
1159041456 18:63326773-63326795 TTGGGTACTAATGATGAGCTTGG - Intergenic
1159629803 18:70736330-70736352 GTGGCCAGGAAGCTTGAGCTCGG + Intergenic
1165823851 19:38694236-38694258 TTGGGGACCAAGGGTGGGCTGGG + Intronic
1166957278 19:46472927-46472949 ATGGGCAGCAAGGTTGAGGTAGG - Intergenic
1167786903 19:51644590-51644612 TTGAGCACGAGACTTGAGCTGGG + Intronic
940650682 2:156437009-156437031 TTTGGCAGGAAGGTGTAGCTGGG + Intronic
942047214 2:172106729-172106751 TTGGTCGCAAAGGCTGAGCTGGG - Intergenic
1172829790 20:37823832-37823854 CTGAGCACGAAGGCTCAGCTGGG - Intronic
1173497239 20:43528563-43528585 TTGGGGGTGAAGGTAGAGCTTGG + Intronic
1175315361 20:58043411-58043433 CTGGGCCCGAAGGCTGGGCTGGG + Intergenic
1175844916 20:62053101-62053123 CTGGGCCCGAAGGCTGGGCTTGG - Intronic
1184870724 22:47236396-47236418 ATAGGCATGAAGGTGGAGCTGGG + Intergenic
959190339 3:103103287-103103309 TTGGGGAGGAGGGTGGAGCTGGG + Intergenic
961365430 3:126396418-126396440 ATGGGCAGGAAGGCTGAGATGGG - Intronic
961754937 3:129121876-129121898 GTGGGCCCGAGGGTTGGGCTGGG - Intronic
964164239 3:153682338-153682360 GTGGACACAAAGGTTGAGGTTGG - Intergenic
969070682 4:4535912-4535934 TGGGACCCAAAGGTTGAGCTGGG - Intronic
971352206 4:25863958-25863980 TTGGGGACGCAGGTTGAGACTGG + Intronic
971581891 4:28352106-28352128 ATGGGCACTAAGGATGAGGTTGG - Intergenic
973602103 4:52552311-52552333 TTGGTCCTGAAGGTTGAGGTGGG - Intergenic
976117122 4:81739658-81739680 ATGGGCATGAAGTTTCAGCTTGG + Intronic
986187115 5:5454410-5454432 TTGTGCACAATGGTTGAGTTTGG + Intronic
989156179 5:38347024-38347046 TTGGGCACCAAGGTGGAAATGGG + Intronic
990488819 5:56284321-56284343 ATGGGCAGGTAGGTTGTGCTGGG - Intergenic
995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG + Intergenic
997370560 5:133357041-133357063 TTGGGCACAAGTGTGGAGCTGGG + Intronic
1002195274 5:177497717-177497739 TTGGGCAGGACGGAAGAGCTGGG - Intergenic
1006625789 6:35396905-35396927 CTGGGCAGGGAGGTTGAGATGGG - Intronic
1007770635 6:44189340-44189362 CAGGGCACTAAGGCTGAGCTGGG - Intergenic
1011756187 6:90500549-90500571 TTGGGAATGAAGGTGGAGCGGGG + Intergenic
1016798226 6:148140918-148140940 TGGGGCAAGAAGGGTGAGATTGG - Intergenic
1018461522 6:164003752-164003774 TTGGGGACGATGGTTGGGGTTGG + Intergenic
1034408760 7:150925034-150925056 TTAGGGAAGAAGGTTGGGCTAGG - Intergenic
1034535790 7:151724921-151724943 TTGGGCACCGAGGAGGAGCTGGG - Intronic
1036720403 8:11169247-11169269 ATGGACACAAAGGGTGAGCTTGG - Intronic
1038325735 8:26571429-26571451 TGAGGCACGATGGCTGAGCTAGG + Intronic
1039719408 8:40146490-40146512 TTGGTCAGGAAGGCTGAGGTGGG - Intergenic
1044492302 8:92833872-92833894 TTGGGAGAGAAGGTGGAGCTGGG + Intergenic
1049453492 8:142675308-142675330 CTGGGCACTAAGGTGGAGATGGG - Intronic
1060188122 9:121576133-121576155 CTGTGCACGAAGGATGAGTTGGG - Intronic
1186487818 X:9946974-9946996 TTGGGAACGGAGCTGGAGCTCGG - Exonic
1186762830 X:12741191-12741213 TTGAGCAGGAAGGTTCAACTTGG - Intergenic
1188522999 X:31059455-31059477 CTGGGCCCGAAGGTTAAGGTTGG - Intergenic
1199311791 X:146329464-146329486 TAGGGCACGATGATTCAGCTGGG + Intergenic