ID: 1085435648

View in Genome Browser
Species Human (GRCh38)
Location 11:76498865-76498887
Sequence AAAAGTAGGTTGAAAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 658
Summary {0: 1, 1: 1, 2: 10, 3: 96, 4: 550}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085435648 Original CRISPR AAAAGTAGGTTGAAAGTAAC AGG (reversed) Intronic
900153506 1:1192904-1192926 AAAAATAGGTGGAAAGTAAAGGG - Intronic
900904632 1:5545384-5545406 ACAAATAGGTAGAAAGTAAAAGG + Intergenic
902553713 1:17234458-17234480 CAAAGCAGGTTGGAACTAACTGG + Intronic
903314676 1:22493082-22493104 AAAAGTATGTGGCATGTAACAGG + Intronic
903584861 1:24405884-24405906 ACAAGCAGGTTAAAAGTAAAAGG - Intronic
905661094 1:39726057-39726079 AGAAGTAGGTTGAAAGTAAAAGG - Intronic
906031490 1:42723828-42723850 AAAAATAGGTTGAAAGTGAAAGG + Intergenic
906230667 1:44160573-44160595 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
906758059 1:48340790-48340812 ACAAGAAGGGTGAAAGTAAAAGG + Intronic
907209401 1:52806675-52806697 AAATATAGGTTAAAAGTAAAAGG - Intronic
908473068 1:64463402-64463424 AAATGTTTGTTGAAATTAACAGG + Intergenic
908805963 1:67932701-67932723 ACAAATAGGTTGAAAGCAAAAGG - Intergenic
908869093 1:68587544-68587566 AAAAGAAGGTTGAAAGCATGGGG - Intergenic
909508376 1:76421169-76421191 AAAAGTATTTTGAAATTCACTGG - Intronic
909879531 1:80856206-80856228 ACAAATAGGTTAAAAGTAAGAGG + Intergenic
910286998 1:85566598-85566620 ACAAGTAGGTTAAAAGCAAAAGG + Intronic
910409110 1:86921886-86921908 ACAAGTAGGTTAATATTAACAGG - Intronic
910416653 1:87007578-87007600 AAAAATGAGTAGAAAGTAACAGG - Intronic
910776302 1:90879149-90879171 ACAAATAGGTTGAGAGTAAAAGG - Intergenic
911346479 1:96702583-96702605 GAAAGTAGTCTGAAAGTAAGTGG + Intergenic
911493877 1:98606019-98606041 AAAGGTCGGTTGAAATTATCTGG - Intergenic
912231923 1:107804104-107804126 ACATGTAGGCTGAAAGTAATGGG - Intronic
913720662 1:121589802-121589824 ATAGGTAGGTTGAATGTAAAAGG + Intergenic
914219147 1:145662449-145662471 ACAAATAGGTTAAAAGTAAAAGG - Intronic
914402395 1:147334925-147334947 AAAGGCAGGTTGGAAATAACAGG - Intergenic
914471730 1:147985320-147985342 ACAAATAGGTTAAAAGTAAAAGG - Intronic
915468124 1:156109609-156109631 AAAACTAGGCCGTAAGTAACAGG - Intronic
915482555 1:156196999-156197021 TCAGGTAGGTTAAAAGTAACAGG - Intronic
915683454 1:157605802-157605824 ATCAGTAGGTTAAAAGTAAGAGG + Intergenic
916325424 1:163553473-163553495 ATAAATAGGTTAAAAGTAAAAGG - Intergenic
917293981 1:173499902-173499924 AAAATGAGGCTGAAAGTTACTGG + Intergenic
918152032 1:181805886-181805908 AAAGTGAGGTAGAAAGTAACAGG + Intronic
919470436 1:197972367-197972389 AAAAGGAGCATCAAAGTAACAGG + Intergenic
919485304 1:198138839-198138861 ATAAGTAGGCTGTAAGTATCTGG + Intergenic
919713066 1:200747472-200747494 ATGACTAGGTTGAAAGTAAATGG + Intronic
920073132 1:203317551-203317573 TAAAGTAGGTGGAAAGGAAGGGG - Intergenic
920886436 1:209933251-209933273 AGAAGTAGGTTGAGCATAACAGG + Intergenic
920998735 1:211020579-211020601 AAAAATAGTTTGAGAATAACTGG - Intronic
921701027 1:218269351-218269373 ATAGGTAGGTTGAAAATAAAAGG + Intergenic
921756179 1:218858232-218858254 AAAAGTAGAATCAAAATAACAGG - Intergenic
921830343 1:219721654-219721676 ATAGGCAGGTTGAAAGTAAAAGG + Intronic
922017215 1:221661915-221661937 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
923139495 1:231148967-231148989 ATAAGTAGCAGGAAAGTAACTGG + Intergenic
923185318 1:231567295-231567317 ACAAGTAGATTGAAAGTAAAAGG + Intronic
923850597 1:237790152-237790174 AGAAGTGGGTTTAAAGTAATAGG - Intronic
924478146 1:244399868-244399890 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1062767168 10:74679-74701 AAAAGAAGGAAGAAAGTAAGGGG + Intergenic
1064158930 10:12926700-12926722 ACAAATAGGTTGAAAGCAAAAGG + Intronic
1064181799 10:13123178-13123200 TAAAGTAGTTTGAAAGGAAAAGG + Intronic
1064210279 10:13355592-13355614 AAAAAAAGGTTAAAAGAAACAGG - Intergenic
1065170729 10:23024873-23024895 ATAGGTAGGCTGAAAGTAAAAGG + Intronic
1065194558 10:23250605-23250627 AAAAGAAGGTGGAAAGGTACTGG - Intergenic
1065238456 10:23680115-23680137 CAAAATAGGTTAAAAGTAAAAGG + Intergenic
1065343732 10:24728160-24728182 GAAAGGAGATTGAAACTAACTGG + Intergenic
1065758599 10:28959719-28959741 AAAAGTAGGATAAAAGTGACTGG - Intergenic
1066011511 10:31198324-31198346 AAAAGAAGGTTGAGAAAAACAGG + Intergenic
1067199910 10:44158796-44158818 ATGAGTAGGTTGAAAATAACGGG + Intergenic
1067454323 10:46405686-46405708 ACAAATAGGTTGAAAGTAATAGG - Intergenic
1067632880 10:47978946-47978968 ACAAATAGGTTGAAAGTAATAGG + Intergenic
1067664349 10:48262233-48262255 ACAAATAGGTTAAAAGTAAAGGG + Intronic
1067724340 10:48757480-48757502 ATAGATAGGTTAAAAGTAACAGG - Intronic
1067762823 10:49061737-49061759 GTAAGTAGATTGAAAGTAAAAGG - Intronic
1068499556 10:57826318-57826340 ACAAATAGGTAGAAAGTAAATGG + Intergenic
1068596500 10:58907772-58907794 AAGAGTATTTTAAAAGTAACAGG + Intergenic
1069220816 10:65880718-65880740 AAAAGGAGATTGAAAGTAGGGGG + Intergenic
1070371144 10:75783263-75783285 AAAAGAAGGTAGAAATTAAAAGG + Intronic
1070372672 10:75799415-75799437 CAAATTAGGTTGAAAGTAATAGG - Intronic
1070372737 10:75800337-75800359 CAAATTAGGTTGAAAGTAATAGG - Intronic
1070623438 10:78031751-78031773 AAAAGTAATTAGAATGTAACAGG + Intergenic
1072886584 10:99281849-99281871 ACAAACAGGTTGAAAGTAAGAGG + Intergenic
1073203590 10:101756022-101756044 ATAAGTAGGCTGAAAGTAAAAGG - Intergenic
1073876191 10:107924059-107924081 AGAAATAGATTGAAAGTAAAAGG + Intergenic
1073911801 10:108354109-108354131 AACAGTAATTTGAAAGTGACCGG + Intergenic
1073992049 10:109272815-109272837 ACAAGTAAGTTGAAACTAAAAGG - Intergenic
1074248614 10:111720049-111720071 AAATGTAGGTTGAAGGTAAAAGG + Intergenic
1074624046 10:115158983-115159005 AAAAGTAGGTTGAAGAAAAATGG + Intronic
1075594807 10:123721344-123721366 TAAAGTGGGATGAAAGTCACTGG + Intronic
1075827009 10:125366367-125366389 ACAAATAGGTTGAAAGTGAAGGG + Intergenic
1076039666 10:127234296-127234318 AAAAATAGTTTGGAAGTAATAGG + Intronic
1076084490 10:127614092-127614114 ACAAGTAGGTTGAAAGTAATAGG + Intergenic
1076341421 10:129748992-129749014 AAAAGTAACTTGAAAGTGAGTGG - Intronic
1076632883 10:131862555-131862577 TAGAGTAGGTTGAAAGTAAAAGG + Intergenic
1076857661 10:133125134-133125156 ACAAGTAGGTTGAAAGTAACTGG - Intronic
1076940311 10:133601859-133601881 ATATGTAGGTTGAAAGTAAAAGG - Intergenic
1077196047 11:1280718-1280740 AGAAGGAGGTGGAAAGCAACAGG + Intronic
1078597531 11:12701289-12701311 AAAAGTTGGTTGAAGGGAAAAGG + Intronic
1079442104 11:20525335-20525357 AACATTGGGTTGAAATTAACAGG - Intergenic
1079612142 11:22446346-22446368 AAAAGTAGGCTGAAAAAGACTGG - Intergenic
1079698654 11:23516528-23516550 ACAAATAGATTGAAAGTAACAGG - Intergenic
1080111841 11:28576589-28576611 GGAAGTAGGAGGAAAGTAACAGG - Intergenic
1080790476 11:35518248-35518270 AAAGGTAGGTTGAAAATTATAGG + Intronic
1081053714 11:38381149-38381171 AAAAGTAAGTTGAAAGCATGAGG - Intergenic
1083291229 11:61691339-61691361 ACAAGAAGGTTGAAAGTGGCTGG + Intronic
1084487583 11:69458938-69458960 AAATACAGGTTGAAAGTAACTGG - Intergenic
1084754505 11:71227349-71227371 ATAGGTAGGATGAAAGTAAAAGG + Intronic
1085177321 11:74501362-74501384 AAAGGCAGGTTGAAAGTAAGAGG - Intronic
1085219036 11:74857275-74857297 ATAAATAGGTTGCAAGTAAATGG + Intronic
1085435648 11:76498865-76498887 AAAAGTAGGTTGAAAGTAACAGG - Intronic
1085544785 11:77307620-77307642 ATAGGCAGGTTGAAAGTAAATGG + Intergenic
1086477663 11:87195758-87195780 AACTGTAGGATGAAAATAACAGG - Intronic
1086772677 11:90788293-90788315 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1087373319 11:97313324-97313346 AAAAGTAGATAGGAAGTGACAGG + Intergenic
1087386654 11:97479186-97479208 TATAATAGGTTGAAAGTAAAAGG + Intergenic
1087607682 11:100396131-100396153 AAAAGTAGCTGGAAACTCACAGG + Intergenic
1087650506 11:100861529-100861551 ATAAGGAGGGTGAAAGTAACTGG + Intronic
1087659362 11:100968156-100968178 ACAAACAGGTTGAAAGTAAAAGG - Intronic
1087707321 11:101508741-101508763 AAAAGTAAGATGAAAGTACTGGG + Intronic
1088093273 11:106067901-106067923 ATAAGTAGGTTGAAAGTAAAAGG + Intronic
1088472975 11:110206561-110206583 AATAGTATGTTGCCAGTAACTGG - Intronic
1088961652 11:114672600-114672622 ACAAGCAGTTTGAAAGTAAAAGG + Intergenic
1089087131 11:115829725-115829747 ATAGGTAGGATGAAAGTTACAGG + Intergenic
1089687364 11:120163710-120163732 ACAAACAGGTTGAAAGTAAAAGG - Intronic
1089853454 11:121519659-121519681 ATAATTAGGTTGTAAGTACCTGG + Intronic
1090814254 11:130277002-130277024 AAAAATAGATTGAAAGTAAAAGG - Intronic
1091012650 11:132019688-132019710 AAAAAGAGGTTAAAAGTAACAGG - Intronic
1091336673 11:134774403-134774425 ACAAATATGTTGAAAGTAATAGG + Intergenic
1091359673 11:134967307-134967329 CAAAATAGGTTGCAAGTAAAAGG + Intergenic
1091506718 12:1076772-1076794 GAAATTATGTTGAAAGTAAATGG - Intronic
1091706122 12:2694655-2694677 AAAAGCTGGGAGAAAGTAACGGG - Intronic
1092608445 12:10146184-10146206 AAAAATAGGTTAAAAGTAAAAGG + Intergenic
1092648425 12:10605480-10605502 AGAAAGAGGTTGAAAGGAACTGG + Exonic
1092837408 12:12503769-12503791 AAAAGTATTTTCAAAGAAACTGG + Intronic
1093122353 12:15286794-15286816 CAGAGTAGGTTAAAAGTAAAAGG + Intronic
1093139041 12:15486399-15486421 AGAAGTAGGCTGAAAGCAAAAGG - Intronic
1093258835 12:16908029-16908051 ACAAATAGATTGAAAGTAAAAGG + Intergenic
1093437141 12:19148783-19148805 AAAAGAAGGATGAAAATAAAAGG + Intronic
1094547288 12:31416562-31416584 ACAAGTAACTAGAAAGTAACTGG - Intronic
1094719192 12:33045333-33045355 AAAATTAGGTTGAAAGAAACAGG - Intergenic
1095101043 12:38184156-38184178 AAAAGCAGGGGGAAAGTAAAGGG + Intergenic
1095136016 12:38604371-38604393 ACACATAGGTTGAAAGTAAAAGG + Intergenic
1095545688 12:43366124-43366146 ATAAATAAGTTGAAAGTAAAGGG + Intronic
1097370994 12:58780881-58780903 AGAATTAGATTGAAAGTAAAAGG + Intronic
1097496501 12:60344792-60344814 AAAAATAGATTGAAAGTAAAAGG - Intergenic
1098130516 12:67345280-67345302 AAAAGTAGGTGGAAAACAAAGGG + Intergenic
1098928550 12:76382041-76382063 ACAAATAGGCTGAAAGTAAATGG - Intronic
1098988109 12:77034206-77034228 AAAAGTACATTGAAAGAAATTGG - Intronic
1100275846 12:93071279-93071301 AAAAGTATGTAGAATGGAACTGG - Intergenic
1100910038 12:99349455-99349477 ACAAATAGGTTGAAAGTTAAAGG + Intronic
1101197915 12:102404589-102404611 AAAAGATGGTAGAAAGAAACTGG + Intronic
1101259420 12:103013405-103013427 AAAAGTAGCATAAAAGGAACTGG + Intergenic
1101894106 12:108742059-108742081 ACAAGTGGGTTGAAAGTAAAAGG - Intergenic
1101933423 12:109034983-109035005 ACAAATAGGTTAAAAGTAAATGG - Intronic
1101994966 12:109518733-109518755 AAAAGTAGGGCCAGAGTAACTGG - Intronic
1102623611 12:114216765-114216787 AAAAGAAGGAAGAAAGGAACCGG + Intergenic
1103634905 12:122295963-122295985 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1103664326 12:122550426-122550448 AAAAATAGCTTTAAAGTAATTGG - Intronic
1105733146 13:23240090-23240112 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1106263114 13:28085788-28085810 ACAAATAGGTTAAAAGTAAATGG - Intronic
1106367473 13:29096408-29096430 AAAAGGAGCTTGAATTTAACTGG - Intronic
1106371225 13:29135392-29135414 ACAAATAGGTTGAAAGTGAAAGG - Intronic
1106460938 13:29967499-29967521 ATAGGTAGGATGAAAGTAAAAGG + Intergenic
1106530500 13:30586284-30586306 AAATGTAGGAGGAAAATAACAGG - Intronic
1106649229 13:31671313-31671335 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
1106802335 13:33269327-33269349 GAAAGTAGGGTGAAAGTTGCCGG - Intronic
1106986599 13:35359376-35359398 ACAAGTATGTTGAAAGAGACAGG - Intronic
1107044551 13:35980978-35981000 ACAAATAGGTTAAAAGTAAATGG + Intronic
1108864586 13:54907291-54907313 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1109204873 13:59470729-59470751 ACAAATAGGCTGAAAGTAAAAGG + Intergenic
1109675413 13:65669493-65669515 ACATATAGGTTGAAAGTGACAGG - Intergenic
1110023031 13:70499730-70499752 ATAAGTAGGTTAAAAGTAAAAGG + Intergenic
1110061954 13:71052675-71052697 ACATGTAGATTGAAAGTAAAGGG - Intergenic
1110062037 13:71054314-71054336 ACATGTAGATTGAAAGTAAAGGG - Intergenic
1110350297 13:74499852-74499874 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1110566092 13:76959091-76959113 AATAGAAGCATGAAAGTAACTGG + Intergenic
1110964323 13:81673489-81673511 ACAGGTGGGTTGAAAGTAAAAGG - Intergenic
1111035189 13:82662689-82662711 AAAAGTAAGTTGAAAATATTTGG + Intergenic
1111131441 13:83982034-83982056 AAAAATAGGGTGTACGTAACAGG - Intergenic
1111439388 13:88259715-88259737 AAAAGAAGGTTGAAAATGACAGG - Intergenic
1111760057 13:92452149-92452171 AAAACGATGGTGAAAGTAACTGG + Intronic
1112270941 13:97969084-97969106 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1112534804 13:100242192-100242214 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1112758311 13:102665369-102665391 AAAATTAGGTTAAAACTATCTGG + Intronic
1112772844 13:102810304-102810326 ACAAATAGGCTGAAAGTAAAAGG - Intronic
1112877145 13:104057235-104057257 ACAAATAAGTTGAAAGTAAAAGG - Intergenic
1112919103 13:104588207-104588229 AAAAGTAGGTAGAAATTAATTGG + Intergenic
1113631504 13:111890069-111890091 ATAAGTAGGTTGAAAGTGAAGGG - Intergenic
1113826165 13:113255601-113255623 AAAACTATGGTGACAGTAACAGG - Intronic
1114369673 14:22072211-22072233 ACAAATAAGTTGAAAGTAAAAGG - Intergenic
1114534305 14:23413161-23413183 AAAATTAGGTGGAAGGGAACTGG + Intronic
1114858821 14:26490038-26490060 AAAAGTAGATTAGAGGTAACTGG - Intronic
1114878272 14:26750863-26750885 AGAAGTAGGTTTAAAGCAAAAGG - Intergenic
1115254826 14:31388668-31388690 TAAACTAGGTTGCAAGTAAGAGG - Intronic
1116009751 14:39337159-39337181 ATAAGTAGGTGGAAAGTAAAAGG + Intronic
1116180865 14:41532397-41532419 ACATGTAGGTTGAAAGTATAAGG - Intergenic
1116611782 14:47083710-47083732 ATAGGTAGGTTAAAAGTAAAAGG + Intronic
1117462698 14:55961656-55961678 CAATGTAGGTTGAAGGTAAATGG + Intergenic
1117922690 14:60741813-60741835 ACAAATTGGTTGAAAGTAAATGG - Intronic
1117991304 14:61436526-61436548 AAAAATAAGTTGAAAATAAATGG - Intronic
1119002697 14:70897289-70897311 AAAAGTATGTTGGAAGTTCCTGG + Intergenic
1119143290 14:72287333-72287355 AGTAGTATGTTGAAAGTAAGTGG + Intronic
1119283079 14:73427093-73427115 TAAAGAAGGCTGAAAGCAACTGG + Intronic
1119671388 14:76521605-76521627 TTAAATAGGTTGAAAGTAAAAGG - Intergenic
1120263702 14:82221730-82221752 AAAAAGAGATTGAAAGTAAAAGG + Intergenic
1121036800 14:90712031-90712053 ACAAATAGGTTGAAAATAAAAGG + Intronic
1122311147 14:100795729-100795751 ACAAATAGGTTAAAAGTAAAAGG + Intergenic
1123559446 15:21472582-21472604 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1123990086 15:25676781-25676803 GATAGTGGGTTGAAAGTAAAAGG - Intergenic
1124009662 15:25827926-25827948 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1124131265 15:26988501-26988523 AAACATAGGTTAAAAGTAAAAGG - Intronic
1124162090 15:27281167-27281189 ATAGGTAGGGTGAAAGTAAAAGG - Intronic
1124242309 15:28038953-28038975 ATAAATAGGTTGAAAGTGAAAGG + Intronic
1124418885 15:29499875-29499897 AAAAACAGGTTGAAAGTAAAAGG + Intronic
1125446034 15:39757869-39757891 AAAAGTAGGGTCAACGTAAAAGG - Intronic
1125924851 15:43554549-43554571 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1125972821 15:43925887-43925909 AAAATGAGATGGAAAGTAACTGG - Intronic
1125994901 15:44149546-44149568 ACAAGTAGGTTGAAAGCGAAAGG + Intronic
1128596364 15:68954881-68954903 ATAGGCAGGTTGAAAGTAAAAGG - Intronic
1128948325 15:71847616-71847638 AAAAGTAGGTTTATAGCAAAAGG + Intronic
1128999945 15:72323832-72323854 ATACGTAGCTTGAAAGTAAAAGG - Intronic
1130142284 15:81237778-81237800 ACAAATAGGTTGAAAATAAAAGG - Intronic
1130735396 15:86542882-86542904 ACAGATAGGTTGAAAGTAAAAGG - Intronic
1132140846 15:99393176-99393198 ACAAGTAGGCTGAAAGTAAAAGG + Intergenic
1132267858 15:100492568-100492590 ACAAATAGGTTGAATGTAAAAGG - Intronic
1132296967 15:100745047-100745069 AAAAATAGGTTAAAAGAAAATGG - Intergenic
1132303995 15:100795519-100795541 ACACATAGGTTGAAAGTAAATGG + Intergenic
1202967792 15_KI270727v1_random:199742-199764 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1132620390 16:864281-864303 ATAGGCAGGTTGAAAGTAAAAGG - Intronic
1133433666 16:5760811-5760833 AAAAGTAGGTTGGTCGTTACTGG + Intergenic
1133646740 16:7771476-7771498 AAAAATAGTTTGGAAGTAACCGG - Intergenic
1134904836 16:17971487-17971509 AAAAGAAGGATGAAAGAAAAAGG + Intergenic
1135962237 16:27005318-27005340 ATAGGTAGGTTGAAAGTAAAAGG + Intergenic
1136280655 16:29208179-29208201 ACAAGTAGGTTAAAAGTAAGAGG + Intergenic
1136296313 16:29305440-29305462 AAAAGTATTTTGAAAGAAAATGG + Intergenic
1137453412 16:48598464-48598486 AAAAGAAGGTGGAGAGTCACAGG + Intronic
1137475670 16:48807213-48807235 AAATGTAGATTTAAAGTAAATGG + Intergenic
1137580237 16:49629192-49629214 ACAGGTAGGTTAAAAGTAAAAGG - Intronic
1138260102 16:55612910-55612932 ATAAATAGGTTGAAAGTAAATGG - Intergenic
1138624608 16:58240041-58240063 ACAAGTGGGTTAAAAGTAAAAGG - Intronic
1138785628 16:59842285-59842307 ACAAATAGATTGAAAGTAATAGG - Intergenic
1138804173 16:60074627-60074649 AACAGAAGGTTGAAAGTCTCTGG - Intergenic
1139266169 16:65640421-65640443 AAAAGAAGGTTGATGGTAAAGGG - Intergenic
1139642951 16:68306125-68306147 AAAAGTAGGTAGAATAGAACTGG - Intronic
1139682849 16:68578938-68578960 ACAAACAGGTTGAAAGTAAAAGG + Intergenic
1140180506 16:72712472-72712494 ATAAATAGGTTGAAAGTGAAAGG - Intergenic
1141208664 16:81956079-81956101 CAAAGTAGGTTAAAGGTCACCGG - Intronic
1142085012 16:88174122-88174144 ACAAGTAGGTTAAAAGTAAGAGG + Intergenic
1142277505 16:89129476-89129498 ACAGGTAGGTTGGAAGTAAAGGG - Intronic
1143629091 17:8126845-8126867 TAAAACAGGTTGAAAGAAACGGG - Intergenic
1147481078 17:40763551-40763573 ACAGGTAGGTTGAAAGTAAAAGG - Intergenic
1147501922 17:40973676-40973698 ATAGGTAGGTTGAAAGTAAAAGG - Intergenic
1148449211 17:47763910-47763932 ATAGGCAGGTTGAAAGTAAAGGG - Intergenic
1149092146 17:52796375-52796397 AAAAGTAAGTAGAAAATAGCAGG - Intergenic
1149233052 17:54557581-54557603 ACATGTAGATTGAAAGTGACAGG + Intergenic
1149633465 17:58146116-58146138 AAAAATAGGTTTAAAATAAAAGG + Intergenic
1150024453 17:61657911-61657933 ACAAATAGATTGAAAGTAACAGG - Intergenic
1150033787 17:61771052-61771074 ACAAATAGGTTGAAAGTAAAAGG + Intronic
1150317011 17:64177492-64177514 AAAATTAGCTAGAAAGCAACTGG + Intronic
1150545319 17:66151052-66151074 ATAAATAGCTTGAAAGTAAAAGG - Intronic
1153319223 18:3755411-3755433 ACAAATAGGTTGAAAGCAAAAGG + Intronic
1155027075 18:21950824-21950846 ATATGAAGGTTGAAAGTAAAAGG - Intergenic
1155077722 18:22375487-22375509 ACAAATAGGTTGAAAATAAGAGG + Intergenic
1155181157 18:23348695-23348717 ACAAGTAGGCTGGAAGTAAAAGG - Intronic
1155928166 18:31679859-31679881 AATAGTAGGTTTGAAGAAACAGG - Intronic
1156248636 18:35329280-35329302 AAAAATAGATTAAAAGTAAATGG - Intergenic
1157050259 18:44155473-44155495 AACAGTAGGTTGAAAAAAGCTGG - Intergenic
1157467113 18:47956857-47956879 AAATGAATGTTGAAAGGAACTGG - Intergenic
1157633113 18:49120351-49120373 ATAGTTAGGTTGAAAGTAAAAGG + Intronic
1158958860 18:62570703-62570725 ACAAATAGGTTTAAAGTAAAAGG - Intronic
1159000434 18:62969830-62969852 ACAAATAGGTTAAAAGTAAAAGG - Intronic
1159222629 18:65484627-65484649 AAAATTAGGTAGAAACTGACAGG - Intergenic
1159321315 18:66854230-66854252 AAAAGAAAATTGAAAGTAAGTGG - Intergenic
1160335723 18:78037329-78037351 AAAAAAAGGGTGCAAGTAACTGG + Intergenic
1160398675 18:78591740-78591762 ACAAATAAGTTGAAAGTAAAAGG + Intergenic
1160519869 18:79499760-79499782 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1160535975 18:79592173-79592195 ACATGTAGATTAAAAGTAACTGG + Intergenic
1160626885 18:80215905-80215927 ACAAATAGGTTGAAAGAAAGGGG + Intronic
1164387479 19:27787127-27787149 ACAACTAGGCTGAAAGTAAAAGG + Intergenic
1165182354 19:33983146-33983168 TTAGGTAGGTTGAAAGTAAAAGG + Intergenic
1165919823 19:39289178-39289200 ATAGGTAGGTTAAAAGTAAATGG - Intergenic
1168082585 19:54021128-54021150 AAAAGAAGTTTGAATGTAGCTGG - Intergenic
926633960 2:15161430-15161452 GAAAGTAAGTTTTAAGTAACAGG + Intergenic
926708465 2:15855214-15855236 AAAAGTAGGTTAAAATTACTTGG - Intergenic
926817051 2:16808925-16808947 CAAAATAGATTGAAAGTAATAGG + Intergenic
926896702 2:17698585-17698607 ATAGGCAGGTTGAAAGTAAAAGG - Intronic
927080385 2:19622900-19622922 ACAGGTAGGTTGAAAGTAAAAGG + Intergenic
927223169 2:20734170-20734192 ATAAGTAGGTTGAAAGCAAAAGG - Intronic
928535132 2:32232733-32232755 AAAAATAGGTAGAAGGTAGCGGG + Intronic
928657971 2:33472969-33472991 ACAAGTAGGTTGAGAGTAAATGG + Intronic
928863460 2:35888619-35888641 AATATTAGGTTGGAATTAACTGG + Intergenic
929050497 2:37832644-37832666 AAAAGTAGGTACAAATTAAAAGG - Intergenic
929717100 2:44323569-44323591 AAAAGTAGGTTATAAATTACAGG - Intronic
929984525 2:46714489-46714511 ATAAATAGGTTAAAAGTAAAAGG - Intronic
929985269 2:46725225-46725247 ATAAGTAGGTTAGAAGTAAAAGG - Intronic
930012359 2:46947014-46947036 CAAAGTAGTCTGAAAGTCACAGG + Intronic
930740652 2:54829604-54829626 AAAAGTATGTTAAAAGTAAATGG + Intronic
931341744 2:61408588-61408610 AAAATCAGGTTTAAAGTAAGAGG + Intronic
931341838 2:61409239-61409261 AAAATCAGGTTCAAAGTAAGAGG + Intronic
931816309 2:65905110-65905132 AAAAGAAGGTTCAAAATAAATGG + Intergenic
932473806 2:71986720-71986742 AAAAGAATATTGAAAGTAAAAGG + Intergenic
932639964 2:73435104-73435126 ACAAATAGGTTGAAAGTAGAGGG - Intronic
932647149 2:73514084-73514106 ACAGATAGGTTGAAAGTAAAAGG - Intronic
933551536 2:83783369-83783391 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
934868858 2:97841038-97841060 AAAAGCAGCTTGAAAATGACAGG - Intronic
934905055 2:98192868-98192890 GGAAGTAGGTTGAAAGTGAATGG - Intronic
935271883 2:101441759-101441781 ATAGGCAGGTTGAAAGTAAATGG - Intronic
935323823 2:101916017-101916039 AATGGTAGGTGGAAAGTAAAAGG + Intergenic
935698281 2:105788318-105788340 AAAAGTAGGTTAAAAGGAGAGGG + Intronic
935733639 2:106088060-106088082 ATATGTGGGTTGAAAGTAAAAGG - Intergenic
935799886 2:106685063-106685085 TTAGGTAGGTTGAAAGTAAAAGG - Intergenic
935998838 2:108804216-108804238 ATAAGTAAGTTGAAAGTGAAAGG + Intronic
936259005 2:110942341-110942363 ATAAGTAGGTTAAAAATAAATGG + Intronic
936621562 2:114103749-114103771 AAAAGTAAGTTAAAAGTGAAAGG - Intergenic
936643016 2:114336801-114336823 AAAAGTAATTTGAAATTAATTGG - Intergenic
936709692 2:115118522-115118544 AGAAGTAGGTTGAAGGCAAAGGG + Intronic
936990628 2:118361379-118361401 ATAAGTAGGTTGAAAGTGAAAGG - Intergenic
937055437 2:118931251-118931273 ACAAGTAGGTTGAAAGTGAAAGG - Intergenic
937163371 2:119787800-119787822 AAAAATTGGTTGAAAGCATCAGG + Intronic
937351678 2:121168617-121168639 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
937946725 2:127345167-127345189 CAAAATAGGTTGACAGTAAAAGG + Intronic
937962438 2:127470600-127470622 AAAAATAGATTTAAAGTAAGTGG - Intronic
938075755 2:128334612-128334634 AAAGACAGGTTGAAAGTAAAAGG + Intergenic
938115217 2:128597829-128597851 AAAAGGAAGTTGAAAGGAAAGGG + Intergenic
938172794 2:129096341-129096363 ACAAATTGGTTGAAAGTAAAAGG - Intergenic
938395420 2:130943312-130943334 AAAGGCAGGTAGAAAGTAAAAGG - Intronic
939068299 2:137509986-137510008 ATAAATAGGTTGAAAATAAAGGG - Intronic
939157093 2:138538551-138538573 AAAAATAGGTTGAAAGTGAAAGG - Intronic
939664000 2:144927515-144927537 ACCAATAGGTTGAAAGTAACAGG - Intergenic
940305889 2:152225995-152226017 AAAAGTAGGGTGAAAGTGCCAGG + Intergenic
941230507 2:162905981-162906003 AATATTAGTTTGAAATTAACAGG - Intergenic
941284874 2:163598250-163598272 TAAAGAAGGTTGAAAGAAATGGG - Intronic
942705942 2:178772588-178772610 AAAAGTAGGAAGAAAATAAAAGG + Intronic
942791305 2:179764317-179764339 AGAGGTATGTTGAAAGTAAAAGG - Intronic
943318862 2:186422118-186422140 AAACGAAGGTTGAAAATAATGGG + Intergenic
943343420 2:186708854-186708876 ATACTTAGGTTGAAAGTAAAAGG + Intronic
943447125 2:188000868-188000890 ACAAGTTGGTTGTAAGTATCTGG - Intergenic
943614368 2:190075697-190075719 ACAGGTAGGTTGAAAGTGAATGG - Intronic
943877320 2:193086843-193086865 AAAACTAGGCTGAAATTAAAGGG + Intergenic
945704957 2:213218455-213218477 AAAAATGGGTTGAAGGTAAAAGG + Intergenic
946118517 2:217487044-217487066 ACATGTAGTTTGAAAGTAAGTGG + Intronic
946884331 2:224208109-224208131 AAAGGGAGGTGGAAAGTGACAGG + Intergenic
946911678 2:224467856-224467878 GTAAGTAGCTTGAAATTAACTGG + Intergenic
947223053 2:227812949-227812971 CCAAATAGGTTGAAAGTAAAAGG - Intergenic
947249984 2:228091133-228091155 ATAAATAGGTTGAAAGTAAAAGG + Intronic
947401838 2:229739028-229739050 ACAAATAGGTTCAAAGTAAAAGG + Intergenic
948012326 2:234659250-234659272 AAACTCAGGTTGAAAGTAAAGGG + Intergenic
948024925 2:234769230-234769252 ACAAATAGGTTGAAAGTCTCAGG - Intergenic
1169056947 20:2630488-2630510 AATAGTAGATTGAAAGTAAAAGG - Intronic
1170216771 20:13899777-13899799 ATAAGTAGGTAGAAAGTGATAGG + Intronic
1170489608 20:16859289-16859311 AGAAGTAGGTAGGAAGTCACTGG - Intergenic
1170523529 20:17213339-17213361 AAAAGTAGGTTCAAAGCACCTGG - Intergenic
1171240015 20:23559606-23559628 ATGAATAGGTTGAAAGTAAAGGG - Intergenic
1172414602 20:34754536-34754558 AAAAGTAGGTAAAATGTCACAGG - Intronic
1172532249 20:35640380-35640402 AAAAGGAGGTTGAAAGTCCATGG - Intronic
1173165521 20:40684672-40684694 AAAAGGAGAGTGAAACTAACAGG - Intergenic
1173230960 20:41197530-41197552 ACAAGGAGGTTGAAAGTAAAAGG - Intronic
1175288640 20:57856964-57856986 AAGTTTAGGTTGTAAGTAACAGG + Intergenic
1176923130 21:14713408-14713430 ACAAATAGGTTGAAAATAAAAGG + Intergenic
1177099943 21:16888283-16888305 ATAAGTAGGATGAAAACAACAGG - Intergenic
1178394251 21:32226377-32226399 ATAAATAGGTTGAAAATAAAAGG + Intergenic
1179055716 21:37931501-37931523 ACAAATTGGTTGAAAGTAAAAGG + Intergenic
1183657366 22:39195447-39195469 ACAGGCAGGTTGAAAGTAAAAGG + Intergenic
1184635660 22:45827436-45827458 ACAAATAGGTTGAAAATAAGAGG + Intronic
1185090298 22:48764068-48764090 ACAGATAGGTTGAAAGTAAAAGG + Intronic
949285867 3:2403483-2403505 GAAAGTAGGTTGAGATTTACAGG - Intronic
949301221 3:2586176-2586198 CAAAGTAGGTGGGAAGTATCTGG - Intronic
949941938 3:9161809-9161831 AAAAGAAGTTTGAAAGCTACTGG - Intronic
950912790 3:16612356-16612378 AAAAGCAGTTTCAAAGCAACTGG - Intronic
951176842 3:19611905-19611927 TTAAGTAGATTGAAAGTTACTGG - Intergenic
952022238 3:29037615-29037637 AAAGAAAGGTTGAAAGTAAAAGG - Intergenic
952205137 3:31173732-31173754 AAAAATTGGTAGAAAGAAACAGG - Intergenic
952224667 3:31363095-31363117 AAAATTAGGTGGGAAGTTACAGG - Intergenic
952228333 3:31402494-31402516 ACAAGTAGAAAGAAAGTAACTGG + Intergenic
952511542 3:34062126-34062148 CACAGCAGGTTGAAAGTAAAAGG - Intergenic
953000823 3:38931476-38931498 AAAGGTAGGGTGGAAGTGACTGG + Intronic
953396480 3:42575408-42575430 ATAGGTAGGTTGAAAGTAAATGG + Intronic
953870590 3:46623738-46623760 CAAAATAGGTTAAAAGTAAAAGG - Intronic
954497741 3:50981813-50981835 AAACATAGATTGAAAGTAACGGG - Intronic
954816920 3:53289629-53289651 AAAAATAGATTGAACATAACTGG - Intronic
954829295 3:53405451-53405473 GAAAGCAGGTTGAAAGTAAAAGG + Intergenic
955030851 3:55216318-55216340 CTAAGTAGGTTGAAATTAAAAGG - Intergenic
955680768 3:61499209-61499231 ATAGGTAGATTGAAAGTAAAAGG - Intergenic
956009786 3:64818244-64818266 AACAGTAGGTTCAAAGAAATAGG + Intergenic
956259335 3:67320635-67320657 ATAAATAGTTTGAAAGTAAAAGG - Intergenic
956624552 3:71254221-71254243 AAAAGCAGGTTGAAACCAAGGGG - Intronic
956639789 3:71404903-71404925 AAAAGGAGGTTGAAAGCCATGGG - Intronic
956690009 3:71867735-71867757 AAAAATAGGCTAAAAGTAAAAGG + Intergenic
956937941 3:74125095-74125117 AAAAGTCGGTGGAAAGTGTCAGG - Intergenic
958004825 3:87797752-87797774 AAAAGAAGATTAAAAGTAGCTGG + Intergenic
958180928 3:90060235-90060257 AAAAGTAGTTTGTAAGAAAAGGG - Intergenic
958578277 3:95981600-95981622 AAAAGTAGTTTGGTAGTTACTGG - Intergenic
958763216 3:98333161-98333183 ATAAATAGATTGAAAGAAACTGG - Intergenic
959508882 3:107187028-107187050 AAAGGTAGATTGAAAATAAAAGG + Intergenic
959613309 3:108318776-108318798 TAAAGTAGGTTGTAAGAAGCAGG - Intronic
960014815 3:112874919-112874941 ACACATAGGTTGAAAGTAAAAGG - Intergenic
960070933 3:113429481-113429503 ACAAATAGGTTGAAAGTAAATGG - Intronic
960114816 3:113883603-113883625 ACAAATAGATTGAAAGTAAAAGG + Intronic
960129556 3:114040649-114040671 ACAAATAGGTTGAAAGGAAAAGG - Intronic
960663788 3:120090625-120090647 GAAAGTGGGGTGAAAGGAACAGG - Intronic
960706175 3:120483293-120483315 ATAGGCAGGTTGAAAGTAAAAGG - Intergenic
960827362 3:121803806-121803828 ACAAGTAGGTTAAAAGTAATGGG - Intronic
960834594 3:121892836-121892858 AACAGTACCTAGAAAGTAACTGG + Intergenic
961973871 3:131001274-131001296 TAAAGAAGGTTGAAAGGAGCAGG + Exonic
963100263 3:141595385-141595407 ACAGATAGGTTGAAAGTAATTGG + Intronic
963171915 3:142260152-142260174 ACAAATAGATTGAAAGTAAAAGG + Intergenic
963224212 3:142844909-142844931 CCAAGTTGGTTGAAAGTAAAAGG - Intronic
963436005 3:145266869-145266891 ATAAGTAAGGTGAAAGTAAAAGG + Intergenic
963554045 3:146763369-146763391 AAAAATAAGTTGAAAGTATCAGG + Intergenic
963688609 3:148470424-148470446 AAACGTTGGTTGAAAGTGAAAGG - Intergenic
963876159 3:150477560-150477582 AAAAATAGGTTGAAAGTAAAAGG - Intergenic
964349089 3:155785001-155785023 ACAAATAGGTTGAAAGTGAAAGG + Intronic
965471191 3:169094501-169094523 GAAAGTAAGATAAAAGTAACTGG - Intronic
966275577 3:178162179-178162201 ACATGTAGGTTTAAAGTAAAAGG + Intergenic
966950275 3:184811057-184811079 AAAAGAAGGTTGAAAGCCACTGG + Intergenic
967461594 3:189753512-189753534 AAAAGTAGGTTAAAAGTAAAAGG - Intronic
968242952 3:197108726-197108748 ACAAAAAGGTTGAAAGTAAACGG - Intronic
968344416 3:197989003-197989025 ACAAATAGGTGGAAAGTAAAAGG - Intronic
969382890 4:6818025-6818047 ACAAATAGGTTAAAAGTAAAAGG - Intronic
970740744 4:19234820-19234842 AAGAGTATGATGAAAATAACAGG - Intergenic
971447798 4:26770235-26770257 ACAATTAGGTTAAAAGTAAAAGG + Intergenic
971483506 4:27135735-27135757 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
971512013 4:27438202-27438224 AAAGATAGGTTGAAATTAGCTGG + Intergenic
971677963 4:29659389-29659411 GAAACTAGGTTGAAACTAATGGG - Intergenic
971893447 4:32557061-32557083 AAAAGTTGCTTGAAAGAAAAAGG + Intergenic
972252297 4:37315556-37315578 ACAAATATGTTGAAAGTAAAAGG - Intronic
973292758 4:48485614-48485636 AAAAGTAAGTTGATACTAATAGG + Intronic
973933922 4:55822596-55822618 AAAACTGGATGGAAAGTAACAGG + Intergenic
974006792 4:56565961-56565983 ACAAATAGGTTAAAAGTAAATGG - Intronic
975086124 4:70341839-70341861 TAAAGTTGGTGGAAAGTCACTGG - Intergenic
976296586 4:83478713-83478735 AAATGTGGGTTAAATGTAACTGG + Intronic
977308866 4:95359265-95359287 AGAAGTAGGTCTAAAGTAATTGG - Intronic
977949958 4:102959182-102959204 ACAAGCAGGTTGAATGTAAAAGG + Intronic
978645825 4:110930136-110930158 AAAAGTTGGTTGGTGGTAACAGG + Intergenic
978746775 4:112203743-112203765 ACAATTAGGTTCAAAGTAATAGG - Intergenic
979290384 4:118973560-118973582 AAAAGTAAGTGGAAAGTACTTGG - Intronic
979745659 4:124209769-124209791 AACAGAAGGTTGAAAAAAACAGG - Intergenic
979983621 4:127288128-127288150 AAAAGTAGCCTGAAAGTATGTGG - Intergenic
980678495 4:136123814-136123836 CAAAGTATGTTGAAGGAAACTGG - Intergenic
981174283 4:141662528-141662550 AAAAACAGGCTGAAAGTAAATGG - Intronic
981428948 4:144638473-144638495 AGAAATAGGTTAAAAGTAAAAGG + Intergenic
981669541 4:147272164-147272186 ATAATTATGTTGAAAGTAAATGG - Intergenic
981720803 4:147799582-147799604 AATAGTAGGATGAAAATGACAGG - Intronic
981838900 4:149088221-149088243 ATAAATAGGTTGAAAATAAAAGG - Intergenic
982017604 4:151170700-151170722 ATAATTAGGCTGAAAGAAACTGG - Intronic
982239745 4:153287283-153287305 TCAAATAGGTTGAAAGTGACAGG - Intronic
982303904 4:153908587-153908609 AATAGTAGGTTGAAAGACAAGGG - Intergenic
982979305 4:162111682-162111704 AAAAAAAGGTTGAAAGAAAAGGG + Intronic
983203988 4:164893671-164893693 AAAAATAGATTGAAAGTCAAAGG - Intronic
984091620 4:175381926-175381948 TAAAGCAGTTTGAAAGTAAAGGG + Intergenic
984149165 4:176105008-176105030 ACAAATAGATTGAAAGTAAAAGG + Intronic
984291746 4:177804560-177804582 AAAAGAAGGTTGAGAATCACTGG + Intronic
984781422 4:183529671-183529693 AAGAGTGTGTGGAAAGTAACAGG - Intergenic
984998041 4:185455117-185455139 AAAGGTAGGTTAAAAGTAAAAGG + Intronic
985087789 4:186331651-186331673 ACAAGCAGGTTGAAAGTAAAAGG - Intergenic
985368420 4:189259310-189259332 AAAGATAGGTTGAAAGCATCTGG + Intergenic
985533851 5:450887-450909 ACAAATAGGTTGAAAGTAAAAGG - Intronic
985798923 5:1989185-1989207 AAAAATAGATTAAAAGTAAAAGG + Intergenic
985842158 5:2315540-2315562 AAAGGCAGATTGAAAGTAAAAGG - Intergenic
986343902 5:6816698-6816720 GCAAATAGGTTGAAAGTAAAAGG - Intergenic
986777380 5:11029148-11029170 AGAAATAGATTGAAAGTAAAAGG - Intronic
987256838 5:16163591-16163613 TCAAATAGGTTGAAAGTAAAAGG + Intronic
988009704 5:25465937-25465959 AAAAATAGATTTAAAATAACGGG + Intergenic
988026804 5:25704932-25704954 ACAAATAGATTGAAAGTAAAAGG - Intergenic
988342658 5:29994083-29994105 AAATGAAGGCTGAAAGAAACAGG - Intergenic
988641317 5:33043378-33043400 AAAAGTGTGTTAAAAGTAAAGGG + Intergenic
988650549 5:33144990-33145012 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
989436946 5:41425221-41425243 ACAAAAAGGTTGAAAGTAAAGGG - Intronic
990234187 5:53749336-53749358 AAACGTAGGTTGAAAACAAAGGG + Intergenic
991140635 5:63237470-63237492 TAAAATAGATTGAAAGTAAAAGG - Intergenic
991590062 5:68241879-68241901 TAAATTAGTTTGAAGGTAACTGG - Intronic
992279983 5:75164417-75164439 AAATGTAGGTTTAAAGTAGGTGG + Intronic
992455979 5:76915807-76915829 TAACGTATGTTGAAAGTAAAAGG + Intronic
992831814 5:80601039-80601061 AAAGGTAGGTAGAAGGGAACTGG - Intergenic
993135776 5:83960986-83961008 ACAAATAGGTTAAAAGTAAAAGG + Intronic
993803932 5:92380260-92380282 CAAAGTAAGTTCAAAGTCACAGG - Intergenic
994154510 5:96487680-96487702 TAAAGAAGGTTCAAATTAACTGG - Intergenic
994336381 5:98571205-98571227 AATATTAGGTAGAAACTAACAGG + Intergenic
994609751 5:102020921-102020943 AAACATAGGTTGAAAATAAAGGG + Intergenic
995594913 5:113737373-113737395 CAAAATTGGTTGAAAGTAAAGGG + Intergenic
995773102 5:115693745-115693767 ATAAATAGGTTGAAAGTGAAGGG - Intergenic
995840451 5:116438854-116438876 AAAGTTAGTTTGAAAGTAAGAGG - Intergenic
996513775 5:124347230-124347252 ACAGGCAGGTTGAAAGTAAAAGG + Intergenic
997018774 5:129971113-129971135 ATGAGGAGGTTGAAAGTGACAGG + Intronic
997576658 5:134983561-134983583 ACAAATAGGTTGAAAGTGAAAGG + Intronic
997994061 5:138571627-138571649 AATAGTAGTTTGAAAGTAAAGGG - Intronic
998281867 5:140817622-140817644 AAAAGTAGGGTACAAGTAAATGG - Intronic
999067604 5:148707008-148707030 ATAAATAGATTGAAAGTAAAAGG + Intergenic
999130968 5:149282895-149282917 AAAAGTAGTTTGAAAAACACTGG - Intronic
999355205 5:150922101-150922123 ATAGGTAGGTTAAAAGTAACAGG + Intergenic
999590988 5:153145609-153145631 AAACATAGGCTGAAAGTAAATGG + Intergenic
1000436630 5:161218620-161218642 CAAACTAGGTGGAAAGTTACAGG + Intergenic
1000476925 5:161721390-161721412 TCAAGTAGGTTGAAAGTGAAAGG - Intergenic
1000859806 5:166443500-166443522 AAAAATAGGTTGAAAAAAATCGG - Intergenic
1001364719 5:171124987-171125009 ACACGTAGATTGAAAGTAAAGGG + Intronic
1002768980 6:272275-272297 ACAAAAAGGTTGAAAGTAAAAGG - Intergenic
1004308980 6:14527069-14527091 ATAAATAGGTTGACAGTAAGTGG + Intergenic
1004377620 6:15104380-15104402 AAAAGTAGGGTGAATGGATCTGG + Intergenic
1005590157 6:27315392-27315414 ACAAGTAAATTGAAAGTAAAAGG + Intergenic
1006501191 6:34459953-34459975 AAAAGAAAGTTAAAATTAACTGG + Intergenic
1007053609 6:38859205-38859227 AACAGATGGTTGAAAGTAGCTGG + Intronic
1007297904 6:40841670-40841692 TTAGGTAGGTTGAAAGTAAAGGG - Intergenic
1008371955 6:50742761-50742783 AAAAGTATCTTGTAACTAACAGG - Intronic
1008410753 6:51175835-51175857 CAAACTGGGTTGAAAGAAACAGG + Intergenic
1008854708 6:56068988-56069010 AAAACTTGTTTGCAAGTAACTGG + Intronic
1008883051 6:56400782-56400804 AAAAATAGGTTGAAAATTAAAGG - Intergenic
1009590055 6:65656585-65656607 AAGAAAAGTTTGAAAGTAACTGG + Intronic
1010431281 6:75781229-75781251 AAAAGTAGGTTCATAGAAAGGGG + Intronic
1010675978 6:78743891-78743913 ACAAATAGCTTGAAAGTAAAGGG - Intergenic
1010698346 6:79007408-79007430 AAAGGTATGTTGAAAAAAACTGG + Intronic
1010915202 6:81608282-81608304 AAGAGTATGTTTAAAGCAACTGG + Intronic
1011845376 6:91556919-91556941 ATAAATAAGTTGAAAGTAAAAGG + Intergenic
1011918183 6:92536442-92536464 AAAAGTAGGTTTAAAAAAAAAGG + Intergenic
1012266814 6:97155040-97155062 ATAAATAGATTGAAAGTAAAAGG - Intronic
1012425648 6:99111493-99111515 TAAGGTAGTTTGAAAGGAACTGG + Intergenic
1012559154 6:100557630-100557652 AAAATTAGGTTAAAAGTGAAGGG - Intronic
1012735350 6:102932707-102932729 ACAGGTAGATTGAAAGTAAAGGG + Intergenic
1012782091 6:103574227-103574249 ATAATTAGGTTGACAGTAAAAGG - Intergenic
1013675113 6:112450794-112450816 ACAACTAGGCTGAAAGTAAAAGG - Intergenic
1014229272 6:118884701-118884723 AGAAATGGGTTGAAAGTAAAAGG + Intronic
1014473638 6:121846505-121846527 AATTGTAGGTTCAAAGTGACGGG - Intergenic
1014605232 6:123465414-123465436 AAAAGAAGGTTGAAATTCATAGG + Intronic
1014934533 6:127372237-127372259 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1017126998 6:151075281-151075303 ATAAGTAGGTTAAAGGTAAAAGG + Intronic
1017551681 6:155516476-155516498 ATAAGTAGGTTGAAAGTAAATGG - Intergenic
1018402437 6:163438071-163438093 AAAGGAAGGTAGAATGTAACAGG - Intronic
1018552353 6:165012246-165012268 AGAAGGAGGTAGAAAGTAAAGGG + Intergenic
1019233840 6:170592191-170592213 ACAAATAGGTTGAAAGAAAGGGG + Intergenic
1020771359 7:12399204-12399226 ACAATTAGATTGAAAGTAAAAGG + Intronic
1020773465 7:12424656-12424678 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1021152744 7:17171680-17171702 ATAAATAGGTTAAAAGTAAAAGG + Intergenic
1021397132 7:20164236-20164258 AAAGTAAGGTTTAAAGTAACTGG - Exonic
1022246830 7:28568567-28568589 TAAAGTAGGATGAAAGGAAATGG - Intronic
1022386841 7:29908134-29908156 ACAAATAGGTTGAAAGTGAAAGG + Intronic
1022825158 7:34002871-34002893 ACAAGTAAGTTGAAAGTAAAAGG - Intronic
1023269130 7:38441046-38441068 ACAAATAGGTTCAAAGTAAAAGG + Intronic
1023509621 7:40937763-40937785 AAAAATAGGCTAAAAGTAAAAGG - Intergenic
1023544403 7:41302631-41302653 ATAGGTAGGTTAAAAGTAAATGG - Intergenic
1023573496 7:41598198-41598220 ACAAATAGATTGAAAGTAAGAGG + Intergenic
1024122050 7:46252994-46253016 ATAGGTAGATTGAAAGTAAAAGG + Intergenic
1024298840 7:47869391-47869413 AAAATTAGGTTGTAAGTAAAAGG + Intronic
1024353333 7:48390131-48390153 AAAAGCAGGGTGAGAGGAACTGG - Intronic
1024369956 7:48570627-48570649 ACAAATAGTTTGAAAGTAAAAGG - Intronic
1024494284 7:50026003-50026025 AAAAATAGGTTAAAAGTAAAGGG + Intronic
1026021226 7:66707974-66707996 ACAAATAGGTTGAAAGTAAAAGG - Intronic
1026137024 7:67672562-67672584 CAAAGATGGTTCAAAGTAACTGG - Intergenic
1026351749 7:69522616-69522638 GCAAGTAGGTTGAAAGTAAAAGG - Intergenic
1028431483 7:90751802-90751824 ACAAGTAGGCTCAAAGTAAAGGG + Intronic
1028441077 7:90861544-90861566 TAAAGGAGGCTGAAAGTGACTGG + Intronic
1028481223 7:91307748-91307770 ACAAATAGGTTGAAATTAAAAGG + Intergenic
1028707043 7:93861599-93861621 ACAGGTAGGTTGAAAGTAAGGGG + Intronic
1028818050 7:95171315-95171337 TCAAATAGGTTAAAAGTAACAGG + Intronic
1029024258 7:97398811-97398833 AAAGGTAGCATGAAAATAACGGG - Intergenic
1029038132 7:97543786-97543808 ATGATTAGGTTGAAAGTAAAAGG + Intergenic
1029051892 7:97698550-97698572 ACATGGAGGTTGAAAGTAAAAGG + Intergenic
1029794550 7:102880150-102880172 AAAAATAGTTTGAAAGTTGCTGG + Intronic
1030937660 7:115605473-115605495 ACAATTAAGTTGAAAGTAAAAGG - Intergenic
1031850232 7:126854235-126854257 AAAACTAGCTTAAATGTAACAGG + Intronic
1032605893 7:133352506-133352528 ACAAATAGGCTGAAAGTAAAAGG - Intronic
1032931035 7:136671268-136671290 AAAAGTAGACTGAAAGTAGAGGG - Intergenic
1033788571 7:144763586-144763608 AGAAGTAGGTTTAAGGTAAAGGG - Intronic
1033796105 7:144847428-144847450 AAAGATAGGTTAAAAGTAAATGG - Intergenic
1034128455 7:148695258-148695280 AAAAGTAGGTGGGAAGCAGCCGG - Intergenic
1035597920 8:875107-875129 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1036280749 8:7399008-7399030 AAAGATAGGTTGATAGTAAAGGG - Intergenic
1036340716 8:7912564-7912586 AAAGATAGGTTGATAGTAAAGGG + Intergenic
1036469488 8:9039212-9039234 AAAGGTGTTTTGAAAGTAACAGG - Intronic
1036951327 8:13142564-13142586 ATAAGAAGGTTAAAAGTAAAAGG + Intronic
1037192664 8:16146168-16146190 GAAAGTAGCTTGAAAGAAACGGG - Intronic
1038129960 8:24718917-24718939 ACAAGCAGGTTGAAAGTTAAAGG + Intergenic
1038322851 8:26544783-26544805 ACATGTAGGTTGACAGTAAAGGG + Intronic
1039139168 8:34365303-34365325 ACAAATAGATTGAAAGTAAAAGG - Intergenic
1039362322 8:36890917-36890939 AAAAATAGGTTGAAAGTAAAAGG - Intronic
1039523053 8:38188371-38188393 ACAAATAGTTTGAAAGTAAATGG + Intronic
1039947109 8:42139870-42139892 TAAAGAAGATTAAAAGTAACAGG - Intergenic
1040031233 8:42825692-42825714 AAAAATAGGTTGAAAGCTAAAGG - Intergenic
1040440139 8:47432893-47432915 AAGAGTAGGTTGGAAGAATCAGG + Intronic
1041113807 8:54514213-54514235 AAAAGGAGGTTGAACGTAAAAGG + Intergenic
1042052487 8:64726424-64726446 AAAAGTAGTTTGAATCTCACAGG + Intronic
1042139738 8:65665859-65665881 AAAAGTAGGTTAATGCTAACAGG - Intronic
1042990471 8:74633454-74633476 AAAAGTAGCTTGTGAGTACCTGG - Intronic
1043020971 8:74999345-74999367 AAAAGTATTTTGAAATTAGCAGG + Intronic
1043977849 8:86603141-86603163 AAAAGTGGTTAGAAAGTAACAGG - Intronic
1044080440 8:87875639-87875661 AAATTTAAGTTGAAAGTAAAAGG - Intergenic
1044378866 8:91508555-91508577 ACACATAGGTTGAAAGTAAAAGG - Intergenic
1045167945 8:99627984-99628006 AAAAGTAGTTTGAAAATCTCTGG + Intronic
1046095178 8:109549918-109549940 ACAAATAGGTTAAAAGTAAAAGG - Intronic
1046436689 8:114198748-114198770 AAAAATAGTTTTAAACTAACAGG - Intergenic
1046717018 8:117579142-117579164 AAAGGAAGATTGAAAGCAACAGG + Intergenic
1047028027 8:120845781-120845803 AAAAGTAGGTGGTAAGTACAAGG + Intergenic
1047265734 8:123306710-123306732 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1047483869 8:125310577-125310599 AAAAGGGGGCTTAAAGTAACCGG - Intronic
1047855840 8:128911373-128911395 ACAAATAGGTTGAAAGTGAAAGG + Intergenic
1048108155 8:131435288-131435310 ATAGGTAGGCTGAAAGTAAAAGG + Intergenic
1048388723 8:133939325-133939347 ACAAATAGGTTAAAAGTAAAAGG + Intergenic
1048453402 8:134554438-134554460 AAAAGTAGGACAAAAGGAACTGG - Intronic
1050236155 9:3582623-3582645 CAACGTAGGTTGAAAATAAAAGG + Intergenic
1051379986 9:16447458-16447480 ACAAGTTGGTTAAAAGTAAAAGG - Intronic
1051417950 9:16862475-16862497 AAAAGTAGGTGGAATAGAACAGG + Intronic
1051449581 9:17180028-17180050 ATAGGTAAGTTGAAAGTAAAAGG - Intronic
1051510413 9:17871298-17871320 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1051546658 9:18283300-18283322 AAAGATAGGTTTAAAGTAAAAGG - Intergenic
1051697188 9:19781155-19781177 AAAAGAAGGTTGAAAATAAAAGG + Intronic
1052178167 9:25490483-25490505 AAATGAAGGTAGAAAGAAACAGG - Intergenic
1052541971 9:29823263-29823285 ACAAAGAGGTTGAAAGTAAACGG + Intergenic
1052623716 9:30946741-30946763 ACAAATAGGTTAAAAGTAAAAGG - Intergenic
1055369310 9:75580222-75580244 ATAAGCAGGTTAAAAGGAACTGG - Intergenic
1056146453 9:83735641-83735663 ACAGATAGGTTGAAAGTAAAAGG - Intergenic
1056448772 9:86694069-86694091 TATAGAAGGTTGAAAGTAAATGG + Intergenic
1056696707 9:88862637-88862659 ACAGGCAGGTTGAAAGTAAAAGG + Intergenic
1056861421 9:90187438-90187460 ACAAATAGGTTGAAAGAAAATGG - Intergenic
1057295593 9:93836199-93836221 ACAAATAGGTTGAAAGTGAAAGG - Intergenic
1057373929 9:94500975-94500997 ACAAATAGGTGGAAAGTAAAAGG - Intergenic
1057418828 9:94891288-94891310 ATAGGTAGGTTGAAAGTGACAGG - Intronic
1057456379 9:95216120-95216142 ACAAGTAAGTTAAAAGTAAAAGG + Intronic
1058108464 9:101002974-101002996 AAGAGCAGGATGAAAATAACGGG - Intergenic
1059370450 9:113827730-113827752 ACAGATAGGTTGAAAGTAAAAGG + Intergenic
1059622336 9:116020725-116020747 AAAAGTATGTGGAATGTATCAGG + Intergenic
1059815835 9:117912885-117912907 ACAAATAAGTTGAAAGTAAAAGG + Intergenic
1060431365 9:123553752-123553774 AAAAAAAGGTTTGAAGTAACAGG - Intronic
1061142455 9:128776138-128776160 AGAAATAGGTTCAAAGTAAGAGG + Intergenic
1062604188 9:137337028-137337050 AAAAGAAGGTTGAAAGTAAAAGG + Intronic
1185746510 X:2577707-2577729 AAAAATAGTTTGAAACAAACTGG - Intergenic
1186849415 X:13565836-13565858 AAAAGAAGATTGAAAGTGATTGG + Intergenic
1187282878 X:17874524-17874546 ATAGGTAGGTTAAAAGTAAGAGG - Intergenic
1187284312 X:17888914-17888936 ATAGGTAGGTTGAAAGTAAAAGG + Intergenic
1187595617 X:20769133-20769155 AAACATAGGTTAAAAGTAAAAGG + Intergenic
1187640181 X:21279001-21279023 AAACATAGGTTCAAAGTAAAAGG + Intergenic
1187777693 X:22781399-22781421 AAAGGCAGGTTGAAAATAAAAGG + Intergenic
1188220014 X:27530097-27530119 GAAAGCAGTTTGAAAATAACTGG + Intergenic
1188617037 X:32170135-32170157 AAAAATATGTCAAAAGTAACAGG - Intronic
1188935002 X:36164519-36164541 AAAAATAGATTGAAAGTAAAAGG - Intergenic
1189426119 X:40901991-40902013 AAAGGCAGATTGAAAGTAAAAGG + Intergenic
1189824336 X:44901855-44901877 AAAAATAGGTTGAAACTAAAAGG - Intronic
1191023795 X:55891526-55891548 ATAGGTAGGTTGAAAGTAAAAGG - Intergenic
1191632862 X:63341520-63341542 ATAAATAGGTTGGAAGTAATAGG + Intergenic
1191712532 X:64165705-64165727 ACAAATAGGTTGAAAGTAAAAGG - Intergenic
1191781258 X:64869008-64869030 ACAAATAAGTTGAAAGTAAGAGG - Intergenic
1192024776 X:67437900-67437922 AAAAGTGGGTTGAAAGTGAGTGG - Intergenic
1192187244 X:68957080-68957102 ACAGATAGGTTGAAAGTAAAAGG + Intergenic
1192540272 X:71963570-71963592 ACAAATAGATTGAAAGTAAAAGG + Intergenic
1192593072 X:72377671-72377693 ACACGTAGGTTGGAAGTAAAAGG - Intronic
1192747371 X:73952454-73952476 ATAAGCAGATTGAAAGTAAAAGG + Intergenic
1192828131 X:74720248-74720270 ACAAACAGGTTGAAAGTAAGTGG + Intergenic
1192918050 X:75675009-75675031 ACAAATAGGTTGAAAGTAAAAGG + Intergenic
1192984955 X:76387962-76387984 AAAAATAGGTTGCAAGTAAAAGG - Intergenic
1193326543 X:80184517-80184539 AAACTTAGGTTGAAAGTAAAAGG - Intergenic
1193608663 X:83601160-83601182 AAAGGTAGGTTGATATTAAATGG - Intergenic
1194376520 X:93140655-93140677 AAAACTAGGTTGAAAGTAAAAGG - Intergenic
1194759575 X:97778711-97778733 ATAAGTAGGTTGAAAGATAAAGG + Intergenic
1194888137 X:99344544-99344566 ACAAATAGATTGAAAGTAAGGGG - Intergenic
1195274307 X:103266152-103266174 ACAAGTAGGTTGAAAATAAAAGG - Intergenic
1196500916 X:116380806-116380828 ACAAGTAGGTTAAAAGAAAAAGG - Intergenic
1196913023 X:120502856-120502878 AAAAGAAGGTGGACTGTAACAGG + Intergenic
1197038978 X:121911517-121911539 AAAAATAGATTGAAATTAAAAGG - Intergenic
1197930343 X:131688256-131688278 CCAAATAGGTTGAAAGTAAAAGG - Intergenic
1198457546 X:136831721-136831743 ACAAGTAGGTTGAAATTAAGAGG - Intergenic
1198458837 X:136844156-136844178 ATAGGTAAGTTGAAAGTAAAAGG - Intergenic
1198551880 X:137753493-137753515 AAGAGCAGTTTGAAAATAACTGG - Intergenic
1198737077 X:139798563-139798585 AAATGTAGGTTTAAATTAAATGG + Intronic
1198759237 X:140013968-140013990 ACAGCTAGGTTGAAAGTACCAGG + Intergenic
1198779502 X:140219609-140219631 ACAGCTAGGTTGAAAGTACCAGG - Intergenic
1199324417 X:146479980-146480002 AGAAATAGGTTCAAAGTAAAAGG - Intergenic
1199926039 X:152465267-152465289 ACAGGTAGGTTGGAAGTAAAAGG + Intergenic
1200369460 X:155707779-155707801 ACAAGGAGTTTGAAAGTAAAAGG - Intergenic
1200396553 X:155993074-155993096 ACAAATAGGATGAAAGTAAAAGG + Intergenic
1202282597 Y:23205702-23205724 AAAAGCAGTTTCAAAGCAACTGG - Intergenic
1202283294 Y:23212817-23212839 AAAAGCAGTTTCAAAGCAACTGG + Intergenic
1202434271 Y:24820087-24820109 AAAAGCAGTTTCAAAGCAACTGG - Intergenic
1202434968 Y:24827203-24827225 AAAAGCAGTTTCAAAGCAACTGG + Intergenic