ID: 1085437421

View in Genome Browser
Species Human (GRCh38)
Location 11:76520638-76520660
Sequence GTCCAAGGTAACATGCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085437421_1085437423 -5 Left 1085437421 11:76520638-76520660 CCTCAGAGCATGTTACCTTGGAC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1085437423 11:76520656-76520678 TGGACTAATGAGACATATAATGG 0: 1
1: 0
2: 0
3: 2
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085437421 Original CRISPR GTCCAAGGTAACATGCTCTG AGG (reversed) Intronic
904382955 1:30123974-30123996 GTCCAAGGTCACATGCTGGATGG - Intergenic
907301015 1:53486308-53486330 TTCCAATGTTAGATGCTCTGTGG + Intergenic
909520772 1:76565316-76565338 CACCAAAGTAACATGCCCTGAGG - Intronic
910123462 1:83815546-83815568 CTCCAAGGGAACATTCTCTGTGG + Intergenic
911532778 1:99065546-99065568 GTCAGAAGGAACATGCTCTGAGG - Intergenic
911537296 1:99115715-99115737 GTACATGGCTACATGCTCTGTGG + Intergenic
911717078 1:101145210-101145232 GTCAAATGTAACCTTCTCTGTGG - Intergenic
916943898 1:169704707-169704729 GTCCATGGTACCCAGCTCTGGGG + Exonic
917759329 1:178138967-178138989 GTCCAATAAAACATGCTTTGTGG - Intronic
919044693 1:192435897-192435919 TTCCCAGGAAACAGGCTCTGAGG - Intergenic
922375870 1:224965103-224965125 GTCCAAGGTCACATGACCAGAGG + Intronic
1067060146 10:43074124-43074146 GTGCAGGGTAAGATGCTCAGTGG - Intergenic
1067139953 10:43648604-43648626 GTCCACGGGACCCTGCTCTGCGG + Exonic
1068601142 10:58957935-58957957 GTCCAAGTTACCATGCTGAGGGG + Intergenic
1074400014 10:113134234-113134256 GGCCAGGGTAAAATGCTCTGAGG + Intronic
1080636357 11:34127240-34127262 GTCCAAGGTCATATGATCAGTGG + Intronic
1081257948 11:40920778-40920800 ATTCAAGGTAACATGCTCACAGG - Intronic
1083325545 11:61871229-61871251 GTCCCTGGTAACTTGCTTTGCGG - Intergenic
1085437421 11:76520638-76520660 GTCCAAGGTAACATGCTCTGAGG - Intronic
1089880006 11:121764542-121764564 GTCCAAGGTAATAACCCCTGCGG - Intergenic
1095142018 12:38675651-38675673 ATCTAATGTAACATGCTCTTGGG - Intronic
1095396655 12:41769795-41769817 ATCCCAGGTGACATGTTCTGTGG + Intergenic
1099594247 12:84638116-84638138 GTTCAAGGCAAGAGGCTCTGGGG - Intergenic
1099701055 12:86082362-86082384 GTCCAAGGAATCACTCTCTGGGG - Intronic
1100706350 12:97203939-97203961 GACCAAGGGCACATGCTCTTGGG + Intergenic
1101503002 12:105321270-105321292 GTCCAAGGTCAAATGCTGTATGG - Intronic
1102148234 12:110670592-110670614 GTCCAAGGTCACACACTGTGGGG + Intronic
1103736754 12:123065498-123065520 TTCCAAGGCACCAGGCTCTGTGG + Intronic
1104914915 12:132259694-132259716 GCCCAAGGTCACATGCAGTGGGG + Intronic
1111606390 13:90545468-90545490 GACCACTGTAACATGCTCTCTGG - Intergenic
1111847087 13:93524491-93524513 GTCCAAGGCTACATCCTGTGGGG - Intronic
1115587741 14:34831700-34831722 GTAGAAGGTAAGATGCTTTGAGG - Intronic
1121528132 14:94633566-94633588 GGCCAGGGTTGCATGCTCTGTGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1126756563 15:51931024-51931046 GTCTTAGGTCACTTGCTCTGGGG + Intronic
1128372272 15:67049108-67049130 GCCCCTGGTCACATGCTCTGTGG + Intergenic
1133912249 16:10076884-10076906 GTGTAAGGTAACATGCTCACAGG - Intronic
1144061959 17:11590984-11591006 GTCCAGGGTCTCATGCTTTGAGG + Intergenic
1144736042 17:17555969-17555991 CTTTAAGGAAACATGCTCTGAGG + Intronic
1145196998 17:20902539-20902561 GTCCCAGGTCTCATCCTCTGTGG + Intergenic
1147981061 17:44274335-44274357 GTCCTTGGGAACATGATCTGTGG - Intergenic
1148678779 17:49460842-49460864 GCCCAAGGGAACATGGTCTGTGG - Intronic
1148913768 17:50957463-50957485 GTTCAAGGTGACATCCTTTGAGG - Intergenic
1150182169 17:63134527-63134549 TTCCAGGGTAACTTGGTCTGTGG + Intronic
1150217977 17:63480812-63480834 GCCCAAGGAAACAAGCACTGTGG + Intergenic
1150295626 17:64005820-64005842 GTCCAAAGCATCAGGCTCTGGGG + Intronic
1151273822 17:73017880-73017902 GTGCAAAGTAAAATGCTATGAGG + Intronic
1159831459 18:73283063-73283085 GTGCAAGGTGACATGCGCTGAGG + Intergenic
1163072374 19:14855025-14855047 GTCCAAGGTAGCATATGCTGAGG + Intergenic
1163076352 19:14895492-14895514 GCCCAAGGTAGCATGTGCTGAGG + Intergenic
1168122187 19:54257669-54257691 GTCCAAGGTCACATAATCGGTGG - Intronic
925056805 2:862813-862835 GCCAAAGGGAACATCCTCTGAGG + Intergenic
926309595 2:11665964-11665986 GTCCATGGTCACAGCCTCTGAGG + Intronic
927122129 2:19975601-19975623 ATCCCATGTAACATGGTCTGCGG - Exonic
933150521 2:78909552-78909574 GTGCAAGGTAACATAGTCTCAGG - Intergenic
938995284 2:136671894-136671916 TTCTAAGGTCACATGTTCTGTGG + Intergenic
944380120 2:199098934-199098956 ATTTAAGGTAAAATGCTCTGGGG + Intergenic
945315630 2:208368127-208368149 GTACCAGGTAAAGTGCTCTGTGG - Intronic
947166202 2:227264468-227264490 GTGTAAGGCAACATGCTATGAGG + Intronic
1169297457 20:4412417-4412439 TTCCAAGGGCACATGCCCTGAGG + Intergenic
1169563584 20:6828329-6828351 TTCCAAGGAAACATGCACTATGG + Intergenic
1171424154 20:25039102-25039124 CTCCATGGGAACCTGCTCTGTGG - Intronic
1171486989 20:25492404-25492426 GACCCAGGTGAGATGCTCTGTGG + Intronic
1172082382 20:32352279-32352301 GTTCCAGGTCACATGCTCTGGGG - Intergenic
1173421854 20:42908194-42908216 GTCCAAGGTCACATGGTCGTGGG - Intronic
1173573696 20:44096182-44096204 ATGCAAGGTAACATGCTCACAGG + Intergenic
1175453173 20:59088393-59088415 GCTCAAGGTCACATACTCTGAGG - Intergenic
1178895005 21:36550782-36550804 GTGCAAGGCAAGAGGCTCTGGGG + Intronic
965242734 3:166224757-166224779 GTACAAGGTACCATGCCCTTTGG + Intergenic
972822308 4:42715922-42715944 GCCCAAGGTGCCAAGCTCTGAGG + Intergenic
973833068 4:54781246-54781268 GTCAAAGATAGCATCCTCTGTGG - Intergenic
979877682 4:125913735-125913757 GTCCAAGTTTACACACTCTGAGG + Intergenic
980841527 4:138266899-138266921 ATACAAGGTAACATGCTCACAGG + Intergenic
982696308 4:158605588-158605610 CTCCAAGACAACATGCTCAGAGG - Intronic
983504967 4:168543111-168543133 GTCCTAGCTGACATGCTCAGAGG - Intronic
985916978 5:2929731-2929753 ATTGAAGGTAACATGCTGTGTGG - Intergenic
989005058 5:36800949-36800971 TTCCTAGGAAACAGGCTCTGAGG - Intergenic
994791783 5:104236444-104236466 TTTCAAGGGAACATGCTATGAGG - Intergenic
998280408 5:140801718-140801740 GTCCAAGGTAAAATATTCAGTGG - Exonic
998486718 5:142509416-142509438 GTCCAAGGGTAAAAGCTCTGAGG - Intergenic
999935347 5:156480110-156480132 GACCAAGGGAACATGCTCACTGG - Intronic
1000238537 5:159387130-159387152 AGCCAAGGTAAGCTGCTCTGGGG - Intergenic
1007563428 6:42829646-42829668 GTTCAACATGACATGCTCTGAGG - Exonic
1008496324 6:52137599-52137621 GTACAAGGTCACATGCTGTCAGG - Intergenic
1010165828 6:72914113-72914135 TACCAAGGTGACATGCTTTGGGG + Intronic
1011363839 6:86558246-86558268 GTCTATGGTAACATGATCTGAGG + Intergenic
1014769797 6:125447718-125447740 GTCCCATGTAACAGTCTCTGAGG + Intergenic
1016582893 6:145649249-145649271 GTCCAAGGTGACATACTTAGTGG - Intronic
1017775540 6:157677792-157677814 GTCCAAGGAGACATGCTTTCTGG + Exonic
1020044481 7:5030990-5031012 GTCCAAAGCCACATTCTCTGAGG - Intronic
1020289839 7:6715012-6715034 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1022010187 7:26302082-26302104 GTCAAAGTTAAAATGCTCTGAGG - Intronic
1023825864 7:44008364-44008386 GTCCAAAGCCACATTCTCTGAGG + Intronic
1025108211 7:56190714-56190736 CTGCAAGGTAAGAAGCTCTGGGG + Intergenic
1026089436 7:67287215-67287237 GTCCAAAGCCACATTCTCTGAGG + Intergenic
1026310019 7:69175387-69175409 CTGCAAGGTAAGAAGCTCTGGGG - Intergenic
1026724845 7:72863285-72863307 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1026746976 7:73021481-73021503 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1026750628 7:73049624-73049646 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1026754275 7:73077734-73077756 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1026757927 7:73105767-73105789 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1027033080 7:74906052-74906074 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1027089476 7:75287717-75287739 GTCCAAAGCCACATTCTCTGAGG + Intergenic
1027093121 7:75315645-75315667 GTCCAAAGCCACATTCTCTGAGG + Intergenic
1027096764 7:75343612-75343634 GTCCAAAGCCACATTCTCTGAGG + Intergenic
1027119031 7:75502533-75502555 GTCCAAAGCCACATTCTCTGAGG + Intergenic
1027127233 7:75565420-75565442 GTCCAAGGAGACAGGCCCTGAGG - Intronic
1027272795 7:76533075-76533097 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1027322583 7:77024068-77024090 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1027326244 7:77052160-77052182 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1029397875 7:100320588-100320610 GTCCAAAGCCACATTCTCTGAGG + Intronic
1029414197 7:100432844-100432866 CTCCCAGGCAACCTGCTCTGAGG - Intronic
1029718467 7:102347484-102347506 GTCCAAAGCCACATTCTCTGAGG - Intergenic
1029754149 7:102561771-102561793 GTCCAAAGCCACATTCTCTGAGG + Intronic
1029772099 7:102660861-102660883 GTCCAAAGCCACATTCTCTGAGG + Intronic
1036578062 8:10047333-10047355 ATCCTAGCTAACATGCACTGAGG + Intergenic
1036738719 8:11342266-11342288 GACCCAGGGACCATGCTCTGTGG - Intergenic
1039115064 8:34083926-34083948 ATCCAAGGTAAAATGCTTTGGGG + Intergenic
1048758073 8:137760847-137760869 ATGCAAGGCAAGATGCTCTGAGG + Intergenic
1049246351 8:141564851-141564873 GTGCAAGATCACATGCTCTGAGG + Intergenic
1055002841 9:71473010-71473032 CTCCAAGGTGGCATCCTCTGAGG - Intergenic
1056312127 9:85351512-85351534 ATCCAAGGTAAGATGCTCCAAGG + Intergenic
1059302307 9:113323720-113323742 CACCAAGGTGACATGATCTGAGG - Intronic
1060141287 9:121212555-121212577 GTCGCAGATACCATGCTCTGGGG - Intronic
1062317865 9:135977334-135977356 GGCCCAGGTCACAGGCTCTGGGG + Intergenic
1190264176 X:48817649-48817671 TGCCCAGGTAACATGATCTGGGG - Intronic
1191914780 X:66189784-66189806 GTCCATGGAAAAATGCTGTGTGG - Exonic
1193089710 X:77481347-77481369 GTCCAAGAGCACAGGCTCTGGGG + Intergenic
1194214218 X:91108701-91108723 GTCCATGGTATCATTGTCTGAGG + Intergenic
1195222516 X:102759820-102759842 GTCCTATGTAATATGCTGTGAGG + Intergenic
1197234133 X:124039837-124039859 GACAAAGGGAACATGCTCTGCGG - Intronic
1200329555 X:155282130-155282152 GACCAAGTTAAAAGGCTCTGGGG - Intronic