ID: 1085437459

View in Genome Browser
Species Human (GRCh38)
Location 11:76521254-76521276
Sequence AATAGGATTTTGAAACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085437459 Original CRISPR AATAGGATTTTGAAACATGA GGG Intronic
902454162 1:16520169-16520191 AATACTATTTTCAAAAATGATGG + Intergenic
907694467 1:56708401-56708423 AATATTAATTTGAAACTTGAAGG - Exonic
907729339 1:57050591-57050613 AATAGAATCTTAAAAGATGAGGG - Intronic
908053418 1:60257408-60257430 AATATGATTTGGAAAAATGTAGG - Intergenic
908284005 1:62573936-62573958 ATTAGGATTTTTAAAAATTATGG - Intronic
908965437 1:69756538-69756560 AATAGGATTTTGAATAAGAATGG + Intronic
909236826 1:73163251-73163273 ACTATGATTTTGACTCATGAAGG - Intergenic
909581511 1:77240936-77240958 ATTATGTTTGTGAAACATGAGGG - Intergenic
909651942 1:77985162-77985184 AATAGGTTATTGAAAGATCAAGG + Intronic
909689112 1:78386434-78386456 AATAGGATTTTAGAACAGGAAGG - Intronic
909754830 1:79212130-79212152 AATAGAACCTTGAAACAAGATGG + Intergenic
909980034 1:82088254-82088276 ATTAGGATTTTAAAACTTCAGGG - Intergenic
910148985 1:84118376-84118398 AATGGGATTTTGGTACAAGATGG - Intronic
910380184 1:86618528-86618550 AAAAGGATTTTGAGACCTAAGGG - Intergenic
911730584 1:101288263-101288285 AATAAGATATTGAAGAATGATGG + Intergenic
912264539 1:108143625-108143647 AAGAAGATTTTGAAACATGAAGG - Exonic
912282626 1:108332298-108332320 AATAAGAGTTCGAAATATGATGG + Intergenic
914775675 1:150732419-150732441 AATAGCCTTTTGTAACTTGATGG - Exonic
914946773 1:152073656-152073678 ATTAGAATGTAGAAACATGAGGG + Intergenic
915155732 1:153874468-153874490 AATAGGATTTTGAAGAAGGGAGG - Intronic
915894935 1:159804455-159804477 AATAGAATTCCGAAAAATGAAGG - Intronic
916053590 1:161052565-161052587 AATTGGAGGTTGGAACATGAAGG + Intronic
916425348 1:164674873-164674895 AAGAGGATCTTTAAACTTGATGG + Intronic
916873680 1:168945513-168945535 AATAAGCTTTTGAAACCTAATGG + Intergenic
917473435 1:175346019-175346041 AATAGTATTTTTAAATATGATGG + Intronic
918425236 1:184402739-184402761 AGTAGGGTATTGGAACATGAAGG - Intronic
919582479 1:199393585-199393607 AAAAGGATCTTGAAATATCAGGG + Intergenic
919675497 1:200378249-200378271 AACATCATTTTCAAACATGAAGG - Intergenic
920788539 1:209066030-209066052 CATTGGATTTTGCAACATGCAGG - Intergenic
922990294 1:229902382-229902404 AATACGTCTTTGAAAAATGAAGG + Intergenic
923389531 1:233500281-233500303 AATAGGCTTTTGATTCAGGAAGG + Intergenic
923819122 1:237416116-237416138 TATTGGATTTGGTAACATGAAGG + Intronic
924315301 1:242789342-242789364 AATAGGATTTTCAATCTGGAAGG + Intergenic
924526282 1:244853345-244853367 AAAGGGATTTTGAACCTTGATGG + Intronic
1063055047 10:2495620-2495642 AAAAGGAATTGGAAACAAGAGGG - Intergenic
1063833244 10:9981221-9981243 AAATGGATTTTTAAACATGCTGG + Intergenic
1063875163 10:10468466-10468488 AATAGAATTTTTAAACAAGTAGG - Intergenic
1064458033 10:15506978-15507000 AATAGAATTTTGAAAATAGAGGG + Intergenic
1069073352 10:64012960-64012982 AGTAGGATTTTGAAAGATAGGGG - Intergenic
1069253736 10:66305493-66305515 AAGGGGATTTTGAATCAGGATGG - Intronic
1069431200 10:68336129-68336151 AATATGATCTTCAAACATAAAGG + Intronic
1069856611 10:71444531-71444553 AATAGGAATTTGGCAAATGAAGG + Intronic
1070267004 10:74913211-74913233 AACAAGATTTTGAAACACCATGG + Intronic
1070493125 10:76995918-76995940 AACAGGATTGGGAAACAAGAAGG - Intronic
1071375480 10:84998063-84998085 AATAGGTGTTTGATACATGTTGG + Intergenic
1071690030 10:87808056-87808078 AATGACATTTTAAAACATGATGG + Intronic
1073260389 10:102185554-102185576 AATATGTTATTGAAACATCAGGG - Intergenic
1074215538 10:111380652-111380674 AATAAAATTTTGATAGATGAAGG + Intergenic
1075016048 10:118910602-118910624 AATAGGACATTGAAAAAAGAGGG - Intergenic
1075184869 10:120246755-120246777 AAGAGATTTTTGAAAGATGATGG + Intergenic
1075693278 10:124415498-124415520 TACAGGATTTTGATACATCATGG - Intronic
1077625320 11:3766387-3766409 AATAAAATTGAGAAACATGAAGG + Intronic
1077929454 11:6715420-6715442 AAAACGATTTTGAATTATGAAGG + Intergenic
1078052541 11:7979673-7979695 AATAAGTTTGTGAAACCTGATGG - Intronic
1079685475 11:23354011-23354033 AATATGTTTTTGAAAACTGAAGG - Intergenic
1079770878 11:24458040-24458062 TATAGGATTTTGAAAACTAATGG + Intergenic
1079903177 11:26213083-26213105 ATTAGGAGTTTTTAACATGAAGG - Intergenic
1079919705 11:26417716-26417738 AATATGATTTTTAAAAATGAAGG + Intronic
1080266214 11:30404702-30404724 AACAAGATATTGACACATGAAGG - Intronic
1080496368 11:32824422-32824444 AATAGAATTTTAGAACAGGAAGG + Intergenic
1080947627 11:36992822-36992844 TATAGGATTTTGACACAGAAAGG + Intergenic
1081558055 11:44185410-44185432 AAGAGGATTTTGAAAAAGGAAGG + Intronic
1082662360 11:55927392-55927414 ATTAGAATTTTAAAATATGAGGG + Intergenic
1082725781 11:56734907-56734929 AATGGGTTTTTTAAACATAAAGG - Intergenic
1082856535 11:57812595-57812617 AATAGCATATTAAAGCATGATGG + Intronic
1083127684 11:60588074-60588096 AATAGAATTTTGAAGTAAGAAGG - Intergenic
1083872709 11:65499281-65499303 AAAAGGTTTCTAAAACATGACGG + Intergenic
1085332401 11:75664980-75665002 AAAAGGGTTTTGAAATATTAAGG - Intronic
1085437459 11:76521254-76521276 AATAGGATTTTGAAACATGAGGG + Intronic
1085603426 11:77876097-77876119 AAGAGGACTAAGAAACATGAAGG + Intronic
1086645364 11:89213112-89213134 AAAAGGATATTGAAATAGGAAGG + Intronic
1086849594 11:91793622-91793644 GATAGGATCTGGAAACCTGACGG + Intergenic
1088665674 11:112091285-112091307 AACCGGATTTGGAAAGATGAAGG - Intronic
1089503397 11:118946546-118946568 CATAGGATTCTGGAACATGGAGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090504329 11:127295325-127295347 AATAAGGTTTTCAAAAATGAAGG + Intergenic
1090569158 11:128028703-128028725 CATAGGATTTTGGAACTAGAAGG - Intergenic
1090622733 11:128575826-128575848 AATAGGCATTTGAAAGGTGAAGG - Intronic
1090989095 11:131800162-131800184 AAACAGATTTTCAAACATGAAGG + Intronic
1092148819 12:6233021-6233043 AAACAGATTTTGAAACAAGAAGG - Intronic
1092854995 12:12665035-12665057 AATAGGTTTTACACACATGAAGG - Intronic
1093220549 12:16415392-16415414 AACAGGAGTTTAAAACATGTGGG + Intronic
1094743261 12:33313910-33313932 AAGAGGAGTGGGAAACATGAAGG + Intergenic
1095375133 12:41518303-41518325 AATACAATTTTTAAATATGATGG + Intronic
1096278157 12:50228395-50228417 CATCGGATTTGGCAACATGAAGG - Intronic
1098239080 12:68447829-68447851 TATAGGATTCCAAAACATGAAGG + Intergenic
1099812483 12:87601952-87601974 TATAGGAATTAGAAACATTAGGG - Intergenic
1100590300 12:96021524-96021546 AATAGTGCTTTGAAACATAAAGG - Intronic
1101843336 12:108342868-108342890 AAGAGGATTTTGAAATCTAAGGG + Intergenic
1102780465 12:115560173-115560195 AACAGTTTTTTGAAACGTGATGG + Intergenic
1103207567 12:119142215-119142237 AATGGGATTTTTAAACATGCAGG + Intronic
1104295667 12:127510253-127510275 AATTGGATTTGCAAACATGGTGG + Intergenic
1104432580 12:128728608-128728630 TATAGGATTTTAAAAGATCATGG - Intergenic
1104551634 12:129762458-129762480 AACAGGGATTTGAAACATCATGG - Intronic
1105450115 13:20491981-20492003 AATAGATATTTGAAACATCATGG + Intronic
1105638315 13:22237397-22237419 AATAGGATTTTGGTAAATGTGGG - Intergenic
1106374067 13:29167064-29167086 ATTAGGCTTTTAAAAAATGAAGG + Intronic
1106946108 13:34829597-34829619 ACTTGGTTTTGGAAACATGAAGG + Intergenic
1107243092 13:38261156-38261178 GATAGGATTTAGAAAGAAGAAGG - Intergenic
1108161718 13:47646891-47646913 AATAGGCTTTTAAAATAGGAGGG - Intergenic
1108258668 13:48634793-48634815 AATGGAATTCTGAAACATTAAGG + Intergenic
1108435632 13:50398858-50398880 AATAGGTTTTTGAGATGTGAGGG - Intronic
1108534617 13:51361514-51361536 AAAAAGTTTTTGAAAAATGACGG + Intronic
1109019364 13:57066643-57066665 AATAGGTTTATGAAATATAATGG + Intergenic
1109056713 13:57559593-57559615 AATAGTATTTTTAAATATGAAGG - Intergenic
1109118009 13:58414582-58414604 ATTAGGATTTTAACACATAAAGG - Intergenic
1109382588 13:61584138-61584160 AATTAGATTTTTAAAAATGATGG + Intergenic
1109526909 13:63587423-63587445 GATAGGGTATAGAAACATGAAGG + Intergenic
1109623593 13:64943628-64943650 AAAAGAATTTTGAAAAAGGAGGG + Intergenic
1111705461 13:91743401-91743423 AATTGCATTTAGAAACAGGATGG + Intronic
1113122859 13:106943056-106943078 AATAGAATTTTTAAAAATCAAGG + Intergenic
1114212510 14:20627086-20627108 AAGAGGATTTTGAATGAGGAGGG - Intergenic
1114294336 14:21315697-21315719 AATAGTATTTTGAGTGATGAAGG - Intronic
1114304174 14:21405887-21405909 AATAAAATTTAAAAACATGAAGG + Intronic
1115092555 14:29595725-29595747 AAAAGGATTTAAAGACATGAAGG + Intronic
1115201549 14:30859319-30859341 TATATAATTATGAAACATGACGG - Intergenic
1116158966 14:41242495-41242517 TATAGGATTTTGAAACTAGTGGG - Intergenic
1116178175 14:41500270-41500292 AATAGGCAATTGAAAAATGAGGG - Intergenic
1116234657 14:42262904-42262926 AATATGATTTTAAATCAAGAAGG + Intergenic
1116980349 14:51163453-51163475 AATGGGATTTTCAAACATTAAGG - Intergenic
1117634871 14:57731272-57731294 CATATTATTTTCAAACATGAAGG - Intronic
1118131895 14:62975539-62975561 AATAATAATTTGAAAGATGAAGG + Intronic
1118267798 14:64311874-64311896 AAAATGATTTTTAAAAATGAAGG + Intronic
1120220416 14:81725765-81725787 AATGGCAAGTTGAAACATGAAGG - Intergenic
1120896852 14:89540931-89540953 AATAAGTGTTTGCAACATGAAGG + Intronic
1120928402 14:89821408-89821430 AATAGGATTTATATACATAAGGG - Intronic
1122966471 14:105129935-105129957 AATTGGATTTTCAAACATTAAGG + Intergenic
1123982451 15:25616232-25616254 AGTAGGATTTTTAAACAAGAAGG + Intergenic
1124189975 15:27566065-27566087 AATAGCATTTTAAATCATCATGG + Intergenic
1124587339 15:31021973-31021995 TATAGGATTTTGAAATATGTGGG - Intronic
1127098673 15:55539677-55539699 AATAGGATTATGATACAGTATGG + Exonic
1130955655 15:88625629-88625651 AATACTTTTTTGAAATATGAAGG - Intronic
1131601319 15:93851671-93851693 AATAGAATAAAGAAACATGATGG - Intergenic
1131843623 15:96465707-96465729 AACAGGAGTTTGAACCAGGAGGG + Intergenic
1131864971 15:96698431-96698453 GATAGCATATTGACACATGAAGG - Intergenic
1132245116 15:100289435-100289457 AAAAGCATTATGAAATATGAAGG + Intronic
1133874152 16:9717687-9717709 AATAGGAGTCTGAGAAATGAGGG - Intergenic
1136357785 16:29757537-29757559 AATGGGATTCTCAAACATGAAGG - Intergenic
1140796082 16:78439565-78439587 CAAAGGATTTAGAATCATGAGGG + Intronic
1141779156 16:86146780-86146802 AAGAGGATTTTAAAACATGCAGG - Intergenic
1142681481 17:1551700-1551722 AAGAGGATTTTGAAAAGAGATGG - Intronic
1143923486 17:10349436-10349458 AATAGGATTCTGAAAAATTGGGG - Intronic
1147857149 17:43489917-43489939 TATAGGATTTTGATATAGGAAGG + Intronic
1148387891 17:47248680-47248702 AATAGTATTTTGAGAAATAATGG + Intergenic
1149017646 17:51926772-51926794 TATAGGATTTTAAAACTGGAAGG - Intronic
1149095602 17:52837038-52837060 ATAAGTATTTTGAATCATGATGG - Intergenic
1149132600 17:53323071-53323093 AATAGTATTTTGAAAGCTGTGGG + Intergenic
1149565926 17:57640402-57640424 AATAGGATTTTAGAATAGGAAGG + Intronic
1150197882 17:63319918-63319940 AATAGTATTTAGAAATATGGAGG - Intronic
1151081283 17:71332506-71332528 AATTGTATTTTGGAACAGGATGG - Intergenic
1151174927 17:72279794-72279816 AATAATATTTTGATACATCAAGG + Intergenic
1153846010 18:9050646-9050668 AATAGGAATTTGCATCATCAGGG - Intergenic
1154993669 18:21619787-21619809 AATAGAATTTTAAAAAAAGACGG + Intronic
1155738741 18:29258716-29258738 AATAGAATTTTGATGCATCAAGG + Intergenic
1156028845 18:32689442-32689464 TATAGGATTTGGCAGCATGAAGG + Intronic
1156562049 18:38136400-38136422 ACTGGGATTTTTTAACATGAAGG - Intergenic
1157895695 18:51464725-51464747 AATAGGATTTTGAAATGGAAAGG - Intergenic
1158157557 18:54442984-54443006 AATGGAATTTTAAAACATCAAGG - Intergenic
1158191645 18:54835653-54835675 AATAGACTTTTCAAACATGATGG - Intronic
1159163331 18:64672251-64672273 AATCGGAATTTGAAACTTAAAGG + Intergenic
1159187859 18:65001657-65001679 AATATGATTTTAAAACATTTTGG + Intergenic
1159480464 18:68984446-68984468 AAGGGGACTTTGAAACATGTGGG + Intronic
1159736729 18:72109020-72109042 TATTGCATTTAGAAACATGAAGG - Intergenic
1163840078 19:19602274-19602296 ATTCGGATTTAGCAACATGAAGG + Intronic
1164144405 19:22502768-22502790 AAAAGGATTTTGGAGCAAGATGG - Intronic
925665882 2:6255689-6255711 AAGAGGAGTTTGGAAGATGAAGG + Intergenic
926444148 2:12923424-12923446 AAAAAGATTTTCAAAGATGAAGG + Intergenic
927092104 2:19719940-19719962 ATGAGGTTATTGAAACATGATGG + Intergenic
927905894 2:26856222-26856244 AATAAGATTTTGAATCAGGCAGG - Intronic
928528662 2:32167590-32167612 AAGAGGATACTGGAACATGAGGG - Intronic
928836257 2:35549890-35549912 AATAGGATTATGCAAGTTGAAGG + Intergenic
928999439 2:37331521-37331543 AATAGGATTAGGAAACATGGGGG + Intergenic
930193674 2:48486841-48486863 AAAAGGATTTTGTAATATAAGGG + Intronic
930696237 2:54414822-54414844 ACTAGCATTTTGAAAAATGATGG + Intergenic
932178731 2:69626394-69626416 AATTGGATTTGGAAATATGGAGG - Intronic
933478050 2:82817810-82817832 AAGAGTATCCTGAAACATGAGGG - Intergenic
936281926 2:111148949-111148971 AATAGGATTTTGCCATACGAAGG - Intronic
936630381 2:114195828-114195850 AATAGAATTTTAAGGCATGAGGG - Intergenic
936671096 2:114657340-114657362 AAAATCATTTTGAAACATAATGG - Intronic
936672325 2:114671583-114671605 AATAGGATTTGGTAATATCATGG + Intronic
937865882 2:126751627-126751649 AGGAGGATTTTGATAGATGAAGG - Intergenic
938908790 2:135865819-135865841 GATAGGATTCTGAAACATCTGGG - Intronic
939231866 2:139437680-139437702 AATGGGATTCTCAAACATTATGG - Intergenic
940180806 2:150930740-150930762 AATACAATATTGAAAAATGAGGG + Intergenic
940743294 2:157537561-157537583 AAAAGGGTTGAGAAACATGAAGG + Intronic
940791004 2:158030223-158030245 AAAATTATTCTGAAACATGAGGG + Intronic
940989685 2:160085028-160085050 AAGAGGATTTTGGGACATTATGG - Intergenic
941263368 2:163325675-163325697 AATAGAATTTTGAGACAGGGAGG - Intergenic
941361194 2:164553463-164553485 AATAGGATTTTTAAAAAATAAGG - Intronic
941547460 2:166870099-166870121 TTTAGGATTTTGTAATATGATGG + Intergenic
941591503 2:167426230-167426252 GATAGAAATTTGAAACTTGAGGG + Intergenic
941736920 2:168987834-168987856 AATAGCATTTTGAATCATGCTGG + Intronic
941831458 2:169965299-169965321 AAAAGGAATTTGACAAATGAGGG - Intronic
942264527 2:174208518-174208540 AATTTGATTTTGAAACATCTTGG - Intronic
943250378 2:185514111-185514133 AACAAGAATTGGAAACATGAAGG - Intergenic
944935425 2:204562144-204562166 AATAGAATTTAGAAATCTGAGGG - Intronic
945592583 2:211752898-211752920 AATAGAATTTTGAAATGTGTAGG - Intronic
946162535 2:217844570-217844592 AATAGGATTTTGAAAGTAAACGG - Intronic
946562649 2:220929667-220929689 AAGAGGTATTTGAATCATGAGGG - Intergenic
948658302 2:239490559-239490581 AAGAGGATTTTTAAAGATCAAGG + Intergenic
1169665126 20:8024987-8025009 ATTAGTTTTTTGAAACATAAGGG - Intergenic
1169737439 20:8852251-8852273 ATTAGGAGTTAGAAAAATGATGG - Intronic
1169825855 20:9768027-9768049 AAGAGGATTTTAAAAGATCAAGG - Intronic
1169825969 20:9768994-9769016 AAAAGGATTTTAAAAGATCAAGG + Intronic
1171005815 20:21464811-21464833 AATAAAATTTTGAAACAATAGGG + Intergenic
1171097585 20:22346670-22346692 AATAGGATCTTGTCACATGAAGG - Intergenic
1172226839 20:33310933-33310955 AATATGATTTAGAAAAATAATGG - Intergenic
1173309376 20:41883338-41883360 CATTGGACTTGGAAACATGAAGG - Intergenic
1174233979 20:49072443-49072465 AATATGATTTGGTAAGATGATGG + Exonic
1174682268 20:52420152-52420174 AATTGTATTTGGAAACATGGTGG + Intergenic
1174855314 20:54039339-54039361 GATGGGATTTTGGAACATCATGG + Intronic
1177053282 21:16266317-16266339 AATCAGATTTTGAAACTTTAAGG + Intergenic
1177131046 21:17256089-17256111 CATGGGATTTAGCAACATGAAGG + Intergenic
1177421659 21:20867266-20867288 AAAAGTAATTTGACACATGATGG - Intergenic
1177671823 21:24241680-24241702 TATAAGATTTTTAAAAATGAAGG + Intergenic
1177708864 21:24744434-24744456 AAAATTATTTTGTAACATGAAGG + Intergenic
1179101290 21:38357360-38357382 AAAAGGATTTAGAAAGATGAAGG + Intergenic
1179277143 21:39902589-39902611 AGAAGGATTTTGAAACATTCTGG - Intronic
1179807041 21:43846009-43846031 AACTGGATTCTGAAACATGGTGG + Intergenic
1180644763 22:17329601-17329623 AATTTGAATTTCAAACATGAAGG - Intergenic
949114778 3:307575-307597 AATAGGATATTAAAAAATCAAGG - Intronic
949749247 3:7331939-7331961 AAAAGGATGTTGAAACTTAAAGG + Intronic
949831332 3:8217643-8217665 AATAGGACTTTCAAAACTGAAGG - Intergenic
950216581 3:11164088-11164110 AGCAGGACTTTGAAACATAAGGG + Intronic
950458715 3:13108205-13108227 ATTAGGGTTTTAAAAAATGAGGG - Intergenic
951443117 3:22745700-22745722 AATTGGCTTTTGTAACATAAAGG + Intergenic
951619984 3:24590794-24590816 AATAGGTTTTTGAAACACAATGG - Intergenic
951788121 3:26446695-26446717 ATTAGTATTTTGTATCATGAAGG + Intergenic
951946088 3:28137990-28138012 CATAGGATTTTGCAAACTGAAGG + Intergenic
952105137 3:30060695-30060717 AATCTTATTTTGAAACATGGGGG - Intergenic
952717589 3:36495698-36495720 AATAGGATTTTAAAATAGGAAGG + Intronic
952731631 3:36642923-36642945 AAAAAGATTTTGAAATTTGAAGG - Intergenic
953559556 3:43976103-43976125 AGTAGGACTTATAAACATGATGG - Intergenic
954525769 3:51269782-51269804 AATAGGCCTTTGATACATGCTGG - Intronic
956226186 3:66961833-66961855 AAAAGGATTTTCACACAAGAGGG - Intergenic
956226759 3:66968887-66968909 AATAGGATCTTGGAGCAAGAAGG + Intergenic
957320549 3:78624845-78624867 AATAGGGCTTTGAAAGATGAGGG + Intronic
957456143 3:80449528-80449550 AATAGCATTTTGTGACATCAGGG + Intergenic
957693408 3:83600692-83600714 AATGGGCTCTTGAATCATGAGGG + Intergenic
957756811 3:84500176-84500198 AATTGGATTTTTAAAAAGGATGG - Intergenic
957809681 3:85204004-85204026 AATATGATTTTGAAACAACTTGG + Intronic
957833780 3:85558557-85558579 AATGTTATTTTGAAAAATGATGG - Intronic
957906921 3:86569213-86569235 AGCTGGATTTTGAATCATGATGG + Intergenic
957935935 3:86942650-86942672 AATAAAATTTTGGAACATGTAGG + Exonic
958573881 3:95922602-95922624 AATAGTATGAGGAAACATGATGG + Intergenic
958783807 3:98575337-98575359 AAACGCATTTTGAAATATGAAGG + Intronic
958795808 3:98705012-98705034 AAGAGGATTTTGGAAATTGAGGG + Intergenic
959136498 3:102429094-102429116 AATAGGATTATGTTGCATGATGG - Intronic
959716352 3:109437562-109437584 AATAGGATTTTCCATGATGATGG + Intergenic
960342654 3:116493570-116493592 AATAGGATTTCAAAATATGTAGG + Intronic
960460228 3:117925191-117925213 ACTAGGATAATGAACCATGAGGG - Intergenic
961609409 3:128124552-128124574 AATATCATTATGAAACCTGAAGG - Intronic
962121541 3:132565644-132565666 AATCGCATATTGAAACATGAAGG + Intronic
963547712 3:146682624-146682646 AATAGGCTTTTTAAACCTTAAGG - Intergenic
963671381 3:148256285-148256307 TATAGAATTGTGAAACCTGAGGG - Intergenic
963964286 3:151348266-151348288 AATAAAATTATGAAAAATGAAGG - Intronic
964418020 3:156470266-156470288 AATTGGATTTTAGAACCTGAGGG - Intronic
964672460 3:159241636-159241658 GTTAGGATTTTGAAATGTGAGGG - Intronic
964959431 3:162405110-162405132 AAGAGGACTTTGAAAAATGGAGG + Intergenic
965127065 3:164644595-164644617 AATGGTATTTAAAAACATGATGG + Intergenic
965169246 3:165239863-165239885 AATAGGATTTTGATAGGAGAGGG + Intergenic
965233642 3:166086848-166086870 AATATGCTTATGTAACATGAAGG - Intergenic
965408452 3:168300261-168300283 AATAAACTTTTGAAACATAAGGG + Intergenic
965998958 3:174923663-174923685 AACAGGATATTGAAAAATGGTGG - Intronic
966064487 3:175801582-175801604 AATTGCATCTTGAAAGATGAGGG - Intronic
967498731 3:190172387-190172409 AATAGGAATTTTGAAAATGAGGG + Intergenic
967591553 3:191281731-191281753 GATAGAGTTTTGAAATATGAAGG + Intronic
967602011 3:191401485-191401507 AATAGGATATATAAATATGAAGG + Intergenic
968756728 4:2419970-2419992 CATCGGATTTTGCAACATCAAGG - Intronic
970669980 4:18385549-18385571 GATAGCATCTTGAAAAATGAAGG + Intergenic
971467407 4:26978159-26978181 AATGGGACTCTGATACATGAAGG + Intronic
971648243 4:29235829-29235851 GATAGGATTTTGAATGAGGAAGG - Intergenic
971780193 4:31023704-31023726 AATAAAATTTTTAAACAGGAAGG - Intronic
973158210 4:46984268-46984290 ACTAGTATTTTGTAAGATGATGG - Intronic
974052345 4:56952653-56952675 GATACTATTTTGAGACATGAAGG + Intergenic
974310587 4:60204387-60204409 AATATGATTTGGATACAAGAGGG + Intergenic
974493805 4:62602006-62602028 AATTTGATTTTGAAAAGTGAAGG - Intergenic
974729923 4:65849608-65849630 AATATTATTTTGAAAAATAATGG - Intergenic
974893050 4:67905573-67905595 AATATGTATTTCAAACATGAAGG - Intergenic
976224127 4:82781740-82781762 AATAGGATGATGCAACAAGAAGG + Intronic
976237173 4:82910836-82910858 CATTGGATTTTGCAAGATGAAGG + Intronic
977203356 4:94142206-94142228 AAGAGGATTTTTAAAAATGAAGG + Intergenic
977380664 4:96269706-96269728 AATAGGATTAGAAAAGATGAGGG - Intergenic
977843444 4:101739105-101739127 AATAGGATTTGGACACAGGAAGG - Intronic
978026337 4:103879362-103879384 AATAGGCTTATCAAACATAAAGG + Intergenic
978698166 4:111608588-111608610 TATAGGATATTGTAACATAATGG - Intergenic
979083442 4:116374067-116374089 AGAAGGATTTAAAAACATGAGGG - Intergenic
980147015 4:128999172-128999194 AATAGAATTTTACAACAGGAAGG - Intronic
980167641 4:129248567-129248589 AATATGATTTTAAAATAAGATGG + Intergenic
980595225 4:134946803-134946825 AATAGGAGATTGGATCATGAGGG - Intergenic
980758521 4:137197552-137197574 AATGGTATTTTGAAACACAATGG + Intergenic
981292100 4:143088320-143088342 TAGAGGATCCTGAAACATGAGGG - Intergenic
982495762 4:156090295-156090317 AAAAATATTTTGAAATATGAAGG + Intergenic
983735430 4:171052954-171052976 AATGGGAATTTCAAACATTAAGG + Intergenic
983816177 4:172129442-172129464 AATAGGATTCTCAAACTTTAAGG - Intronic
983983704 4:174031587-174031609 TGTAGGATTCTTAAACATGAAGG - Intergenic
984142086 4:176015712-176015734 ATTAGGATTTTTAAAGCTGAGGG + Intergenic
984752661 4:183293435-183293457 ACTGGGATTTTTAAACATGAAGG - Intronic
985253985 4:188051241-188051263 AATAAGATTTTGAAACAAAAAGG - Intergenic
986065882 5:4233507-4233529 AATGGGAGGTTGAAGCATGAAGG + Intergenic
986212259 5:5685225-5685247 CATAGGATATCGAAACAAGATGG + Intergenic
987535142 5:19176929-19176951 CACAGTATTTTGAAACATCATGG + Intergenic
988151271 5:27384683-27384705 AAAATGATTTTGATACATTAAGG + Intergenic
988788243 5:34583918-34583940 AAGAGGTTGTTGAAACCTGAAGG - Intergenic
989218198 5:38926746-38926768 AATTGTGTTTTGAAATATGAGGG - Intronic
989627724 5:43447598-43447620 AAAAGTATTATAAAACATGAAGG + Intronic
990276682 5:54204685-54204707 AATAAGATTTTAAAACGTAAAGG + Intronic
990377091 5:55181673-55181695 AATAGTCTCTTGAAACATGGAGG - Intergenic
990686868 5:58313846-58313868 ATTAGGTATTTGAAACCTGATGG - Intergenic
990921768 5:60975880-60975902 AATTGGATTTAGCAACATGTAGG + Intronic
990994917 5:61723039-61723061 AATAGGTCTTTCAAAAATGAAGG - Intronic
991140925 5:63241978-63242000 AAAAAGATTTTGAAATTTGAAGG - Intergenic
991264830 5:64705438-64705460 AAAAAGCTTTGGAAACATGAGGG + Intronic
992297406 5:75338488-75338510 AATGGGAATTAGTAACATGAAGG + Intronic
992408834 5:76485115-76485137 AAAATGATTTTGAAAAAAGAAGG - Intronic
992878426 5:81081098-81081120 AATAATATTTTTAAACATGCTGG - Intronic
992913709 5:81425454-81425476 AATAGGAATTACAAACAAGATGG - Intronic
993490059 5:88536176-88536198 AATAAGATTTAAAAACATGGAGG + Intergenic
993877202 5:93321541-93321563 AAAAGGATTTGGAAAGGTGAGGG - Intergenic
994424361 5:99565076-99565098 ACTAATATTTTGAAACATAAAGG + Intergenic
994478566 5:100302661-100302683 CATAGGTTTTGGAAACATAAAGG + Intergenic
994849646 5:105037541-105037563 AAGCTGATTTTGAAAGATGAGGG - Intergenic
995008527 5:107230806-107230828 AGTAGGATTTTGAAAGATTTTGG + Intergenic
995143894 5:108764771-108764793 AATTGGATTTTGAAAAACTAAGG + Intronic
995169235 5:109087904-109087926 AATTAGATTTTGAAACATTCAGG - Intronic
995696469 5:114883729-114883751 GAGAGGATTTTGAGAGATGATGG - Intergenic
995961774 5:117849882-117849904 AATATTATTTTGAAAAAAGAAGG + Intergenic
996373128 5:122774603-122774625 AATAGAATTTTCTGACATGATGG - Intergenic
997185951 5:131882160-131882182 AATAGTGTTTTAAACCATGATGG - Intronic
999796136 5:154991402-154991424 AACAGGCTTTGGAATCATGAGGG + Intergenic
1000212133 5:159117084-159117106 GATTGGATTTTGAAATATGTAGG + Intergenic
1000355769 5:160393275-160393297 AAGAGGATTATGAAATATAATGG - Exonic
1000787841 5:165568665-165568687 CAGAGGATTTTGATGCATGAGGG - Intergenic
1003357610 6:5388886-5388908 AAAAGGATTTTGAAATATCCTGG - Intronic
1003483337 6:6553352-6553374 AAGAGGAATTTAAAAAATGAAGG + Intergenic
1004339250 6:14793913-14793935 AACATGGTTTTGAACCATGAGGG + Intergenic
1004623906 6:17357003-17357025 AATTGGATTTTTAAACATAAAGG - Intergenic
1008510304 6:52269799-52269821 AATAGCATTTTAAAAGATAAAGG - Intronic
1008792699 6:55257167-55257189 AATTGAATTTTGAAACAAGATGG + Intronic
1009826612 6:68874141-68874163 ATTAGGATTTTCTAAAATGATGG + Intronic
1009989428 6:70823513-70823535 AACTGTATTTTGAAATATGATGG - Intronic
1009992319 6:70858876-70858898 AATAGGATTTTATAATATGAGGG - Exonic
1011887564 6:92116150-92116172 AATAGGAATAGGAAACAGGAGGG + Intergenic
1012141713 6:95633466-95633488 AAAAAGATTTGGAAAGATGAGGG - Intergenic
1012686537 6:102257878-102257900 AAGGAGATTTTGAAACATAAGGG - Intergenic
1014027532 6:116666843-116666865 GATAGTACTTTAAAACATGAAGG - Exonic
1015076142 6:129159905-129159927 AATTGAATTTTAAAATATGAAGG + Intronic
1015217688 6:130768730-130768752 AGTAGGAATGTGAAAGATGAAGG - Intergenic
1015911347 6:138170498-138170520 AAAAGGATTTTAAAATATGAAGG + Intronic
1016451285 6:144185592-144185614 AATAGCTTTTTGAAACAAGTTGG - Intronic
1017629457 6:156382460-156382482 AATAGAATTTTGTAAGGTGAGGG - Intergenic
1017640517 6:156489598-156489620 TATGGGATTTTCAAACATTAAGG - Intergenic
1018386906 6:163312704-163312726 GATAAGATTTTGAAACAAAAGGG - Intronic
1018763944 6:166915080-166915102 AATGGGATTCTCAAACATAAAGG + Intronic
1021119748 7:16785640-16785662 ATTAGGATTTTAAATCATTATGG + Intergenic
1021203257 7:17750400-17750422 AATAGGCCTTTCAAAAATGAAGG - Intergenic
1021571583 7:22071155-22071177 AACAGGGGTTTGAACCATGAGGG + Intergenic
1023491321 7:40745622-40745644 AATAGGCTTTTGAAATTTCAAGG + Intronic
1024441720 7:49427198-49427220 AATAGGCTATAGGAACATGATGG + Intergenic
1024788967 7:52940818-52940840 ACTAGGGTTTTGGAACATGAAGG + Intergenic
1026564645 7:71480009-71480031 AATATGATTTTGACATCTGATGG + Intronic
1027676820 7:81169997-81170019 AAAATGATCTTGAAACATGAAGG + Intergenic
1027766691 7:82352948-82352970 AATACGATTCTGAAACATTTAGG + Intronic
1028118532 7:87029530-87029552 AATATTATTTTGGAACTTGATGG + Intronic
1028623075 7:92845961-92845983 AAAAGGAGTTTGAAACAGGTCGG - Intergenic
1030574039 7:111263906-111263928 CATTGGATTTTGCAACATGCAGG + Intronic
1030602097 7:111604042-111604064 AATAGAATTTGGAAATAAGAGGG - Intergenic
1031656077 7:124357502-124357524 AAAAGGATTCTAAAACATGAAGG - Intergenic
1031849177 7:126842961-126842983 AATACAATTGTGAAAAATGAGGG + Intronic
1032232112 7:130083826-130083848 AAAAGGATGTTTAAAAATGAAGG - Intronic
1032668369 7:134061025-134061047 CAGAGGATATTGAAACATTAAGG + Intronic
1033238884 7:139660639-139660661 AATAGGATTTGGAAACACCTGGG - Intronic
1033489380 7:141826786-141826808 AATAGGCTTTTGACATATAAGGG - Intergenic
1033787325 7:144748613-144748635 AATGTGATTATGAAAAATGATGG + Intronic
1037118934 8:15259897-15259919 AATTGGATGGTGGAACATGAAGG - Intergenic
1037353071 8:17983963-17983985 AATAGGATATAAAAACAAGATGG + Intronic
1037413090 8:18618463-18618485 AATATCATTTTTAAAAATGATGG + Intronic
1039025042 8:33249254-33249276 ATTAGGAGTTTTTAACATGAAGG + Intergenic
1039106207 8:33992711-33992733 GATGGGATTGTGAAACATGCAGG + Intergenic
1039641901 8:39232342-39232364 GATTGGATTTAGAAACATAATGG - Intronic
1040733876 8:50482726-50482748 AATGCAATTATGAAACATGAGGG + Intronic
1040943773 8:52859501-52859523 AATGGGATTCTCAAACATTAAGG + Intergenic
1041028496 8:53711507-53711529 AATAGGATTTTAAGACAGAAAGG + Intergenic
1041620423 8:59961125-59961147 TATAAGATTTTTAAATATGATGG - Intergenic
1042921284 8:73922422-73922444 GATGGGATTTTCAAACATTAAGG - Intergenic
1043188748 8:77190057-77190079 TATAGGATTTAGTAAAATGAAGG + Intergenic
1045129066 8:99128028-99128050 AATAGCCTTTTGAAAAATTATGG + Intronic
1045663425 8:104461641-104461663 AAAATGAGTTTGAAACTTGAAGG + Intronic
1046350120 8:112998645-112998667 AATGGGATTTGGTAACATGGGGG - Intronic
1047899081 8:129400069-129400091 ATTAAGAGTTTTAAACATGAAGG - Intergenic
1048444972 8:134486430-134486452 AAAATGGATTTGAAACATGAAGG - Intronic
1048491507 8:134897927-134897949 AATAGGATCTTGAAATAATAGGG - Intergenic
1049646138 8:143736570-143736592 AAATGGGTTTTGAAACAGGAGGG + Intergenic
1051283269 9:15465910-15465932 ATTAAGATTTTGAAATATGTTGG - Intronic
1051943123 9:22532514-22532536 AAATGGTTTTTGAAACAAGATGG + Intergenic
1052035084 9:23671316-23671338 AACAGGCTTTTGAAGTATGATGG + Intergenic
1052118763 9:24682209-24682231 AATAGGATGTTCAAAGGTGAGGG - Intergenic
1052303475 9:26979343-26979365 AATAGTATTTTAAAACATCGAGG + Intronic
1052580161 9:30345105-30345127 AATAAGATTCTCAAACATCAAGG + Intergenic
1052701164 9:31939574-31939596 AATAGATTTTTGATACATCAAGG - Intergenic
1052934182 9:34079376-34079398 CATAGGATTCTCAAAGATGATGG - Intergenic
1053539881 9:38962615-38962637 AAGAGGATTTGGAAGAATGATGG + Intergenic
1053804237 9:41784765-41784787 AAGAGGATTTGGAAGAATGATGG + Intergenic
1054141045 9:61530694-61530716 AAGAGGATTTGGAAGAATGATGG - Intergenic
1054192544 9:61996260-61996282 AAGAGGATTTGGAAGAATGATGG + Intergenic
1054626259 9:67401301-67401323 AAGAGGATTTGGAAGAATGATGG - Intergenic
1054645861 9:67592431-67592453 AAGAGGATTTGGAAGAATGATGG - Intergenic
1055604095 9:77949834-77949856 AATAGGATTCTGAACCAAGGTGG - Intronic
1057755322 9:97830445-97830467 GATAGATTTTTGAAACATGATGG + Intergenic
1058355341 9:104077712-104077734 AATAGGAGTTTGGCACAAGATGG - Intergenic
1059092496 9:111375025-111375047 AACATGAATTTCAAACATGATGG + Intronic
1059576949 9:115499695-115499717 AACAGGATATTGAGACATGGAGG - Intergenic
1059602356 9:115793555-115793577 AATAGCATGTTGAAAGAAGAAGG - Intergenic
1059613930 9:115928614-115928636 AATAAGAGTTTGAGACTTGAGGG + Intergenic
1060419549 9:123457945-123457967 AATAGGAATTTCAAAACTGATGG - Intronic
1060446002 9:123688868-123688890 ATTAGGGTTTTGTAACATTATGG - Intronic
1186566989 X:10673492-10673514 AAATGGCTTTTGAAACATCAAGG - Intronic
1187125810 X:16453367-16453389 AACAGGATTTTTAAAACTGAAGG + Intergenic
1187356766 X:18581580-18581602 AATAGGTTTTTGAAATGTGTTGG + Intronic
1187985999 X:24811587-24811609 AATAGGAATTAAAAACAAGAGGG - Intronic
1192309085 X:69994716-69994738 AATAGGAGTTTGGAACATTAGGG - Intronic
1193339258 X:80327074-80327096 AACAGGACTTTAAGACATGAAGG + Intergenic
1193891035 X:87046190-87046212 GATATCATTTTGAAACTTGAAGG + Intergenic
1194721367 X:97343842-97343864 TATTGGATTTTGCCACATGAAGG + Intronic
1195453163 X:105038231-105038253 CATTGGATTTTGCAAAATGATGG - Intronic
1196309150 X:114141213-114141235 AATATGATTTTGTAACTTTATGG + Intergenic
1196751342 X:119120314-119120336 TATGGGATTTTGAAGCAAGAGGG - Intronic
1196967066 X:121067946-121067968 AGCAGGATTTTGAGACATGGTGG - Intergenic
1197092960 X:122560177-122560199 AAAAGAATTTTGGAACTTGAAGG + Intergenic
1197529309 X:127603289-127603311 AACAGGAATTTGAAAAAAGATGG + Intergenic
1198094335 X:133363660-133363682 AATTAAATTTTAAAACATGATGG - Intronic
1198729823 X:139717279-139717301 AATTGGTTTTTGGAGCATGAAGG - Intergenic
1200356737 X:155560512-155560534 AGTTGGACTTTGAAACATGGTGG + Intronic
1201735473 Y:17256113-17256135 AATAGGATGGTGAAAACTGAGGG - Intergenic