ID: 1085438071

View in Genome Browser
Species Human (GRCh38)
Location 11:76528355-76528377
Sequence GCATCCAGGGTAGCAGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 431}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085438071 Original CRISPR GCATCCAGGGTAGCAGAGGC TGG Exonic
900153609 1:1193709-1193731 GCACCCTGGGAAGCTGAGGCGGG - Intronic
900170153 1:1263550-1263572 GCACCCACGGTAGAAGAGACGGG - Intronic
900529425 1:3145429-3145451 CCTTCCAGGGCTGCAGAGGCAGG - Intronic
900645027 1:3705146-3705168 GCATTCTGGGGGGCAGAGGCGGG - Intronic
901168747 1:7238769-7238791 GCTTCCAGGGAGGCTGAGGCAGG + Intronic
901284342 1:8064978-8065000 GCTTCCCGGGAAGCTGAGGCAGG + Intergenic
902166490 1:14576033-14576055 GCATCCAGGTTAGGAGTGGTAGG + Intergenic
902401618 1:16160889-16160911 GCAACTAGGGAAGCTGAGGCAGG - Intergenic
902697477 1:18150056-18150078 CCATCCTGGGTAACAGAGGGAGG + Intronic
903270133 1:22183020-22183042 GCATCCAGGGTGGTGGGGGCGGG + Intergenic
903997304 1:27315506-27315528 GCATTTAGGGAAGCTGAGGCGGG - Intergenic
904465245 1:30703829-30703851 CCAGCCAGGGAAGCAGAGGTTGG - Intergenic
904490852 1:30858208-30858230 CCAGCCAGGACAGCAGAGGCGGG - Intergenic
904652676 1:32017717-32017739 GCTACCAGGGAAGCTGAGGCAGG - Intronic
905424478 1:37871950-37871972 GCTACTAGGGTGGCAGAGGCAGG + Intronic
906153282 1:43600125-43600147 GCATCCGGGGTGGAGGAGGCAGG + Intronic
907274761 1:53311035-53311057 ACATCCAGGGTAGCACAGTGAGG + Intronic
908032444 1:60015870-60015892 GCCTCCAGAGTAGCTGAGACTGG + Intronic
908850434 1:68370187-68370209 GCATTTAGGGAAGCAGAGGTGGG + Intergenic
910421018 1:87063579-87063601 GCATTTAGGGAAGCCGAGGCGGG - Intronic
910610987 1:89141866-89141888 GCATCCCTGGGAGAAGAGGCTGG - Intronic
910848036 1:91622791-91622813 GCATCAAGGGTGCCAGAGGGAGG - Intergenic
913271179 1:117095024-117095046 GAACCCAGAGAAGCAGAGGCTGG + Intronic
914473284 1:148002317-148002339 GCATTCAGGGTAGAAGAAGTGGG - Intergenic
914741499 1:150469521-150469543 GCATTTTGGGCAGCAGAGGCAGG - Intronic
916097127 1:161361114-161361136 GCTTTTAGGGAAGCAGAGGCAGG + Intronic
916507948 1:165445015-165445037 GCAGCCCGGGGAGCACAGGCTGG + Exonic
916884525 1:169054067-169054089 GCACCCTGGGAAGCTGAGGCAGG - Intergenic
916934497 1:169613608-169613630 GAATCCAGGGTAACAGGAGCAGG + Exonic
917317844 1:173745272-173745294 GCTTCCCGGGAAGCTGAGGCAGG - Intronic
917450728 1:175145439-175145461 GCCTCTAGGGAAGCTGAGGCAGG + Intronic
917657166 1:177137975-177137997 CCATCCAGGGTACCAAGGGCAGG + Intronic
919231438 1:194779727-194779749 GCTTCCCGGGAAGCTGAGGCAGG - Intergenic
919274059 1:195389613-195389635 GAATAGAGGATAGCAGAGGCTGG - Intergenic
919674829 1:200370925-200370947 GCATTTTGGGAAGCAGAGGCGGG + Intergenic
919819665 1:201465230-201465252 TCTCCCAGGGTAGCAGGGGCAGG + Intergenic
920068233 1:203284228-203284250 GCTTCCAGTCTAGCAGAGGAAGG - Intergenic
920191367 1:204196256-204196278 GCATCCAGGCAGGCAAAGGCAGG - Intronic
920736865 1:208540897-208540919 GCATCCAGGATAGCCGAGTGAGG + Intergenic
920940838 1:210480732-210480754 GCCTAAAGGGAAGCAGAGGCTGG - Intronic
922433855 1:225583562-225583584 GCATTTTGGGAAGCAGAGGCGGG + Intronic
922561873 1:226575446-226575468 GCACCCAGGGTGGGTGAGGCAGG + Intronic
922948383 1:229536707-229536729 GCACTCTGGGAAGCAGAGGCAGG + Intronic
923642035 1:235773068-235773090 GCATCTTGGGAAGCCGAGGCAGG + Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1063394981 10:5678193-5678215 GGATCTAGGGTAATAGAGGCAGG - Intergenic
1064613338 10:17126599-17126621 GCATCCTGGGAAGCACATGCTGG + Intronic
1064995933 10:21296687-21296709 CCAGCCTGGGTAGCAGAGCCAGG - Intergenic
1065220461 10:23491364-23491386 TCAACCAAGGTAGGAGAGGCAGG - Intergenic
1065512176 10:26490376-26490398 GCATTTTGGGAAGCAGAGGCGGG + Intronic
1066298919 10:34079861-34079883 GACTCCAGGGAAGCAGGGGCTGG + Intergenic
1066543765 10:36477052-36477074 GCATTCAGGGAGGCTGAGGCGGG + Intergenic
1067296513 10:44977915-44977937 TCATCCAGGCTAGGAGAGGGTGG + Exonic
1067302201 10:45022082-45022104 GCTTCTAGGGTGGCTGAGGCAGG + Intergenic
1067546585 10:47196496-47196518 GCTCCCAGGACAGCAGAGGCAGG - Intergenic
1069399734 10:68030191-68030213 GCATTCTGGGAGGCAGAGGCGGG + Intronic
1069476513 10:68738166-68738188 GCATACTGGGAAGCCGAGGCGGG + Intronic
1069825118 10:71250168-71250190 GCATCCTGGGGAGCAGGGCCTGG - Intronic
1070524380 10:77282590-77282612 ACATCAAGGGAAACAGAGGCAGG + Intronic
1071125045 10:82324109-82324131 GCACCCTGGGAAGCCGAGGCAGG - Intronic
1071126644 10:82343782-82343804 GCATCCAGGGTGGCATTGGGGGG - Intronic
1071182607 10:83004511-83004533 TCATCAAGGGTCTCAGAGGCAGG - Intergenic
1072211231 10:93248828-93248850 GGATCCAGGTTAGCAGAGGCCGG + Intergenic
1072344881 10:94494971-94494993 GCTACCAGGGAAGCTGAGGCAGG - Intronic
1072349281 10:94542011-94542033 GCTACTAGGGTAGCTGAGGCAGG - Intronic
1072636823 10:97183769-97183791 GCAACCAGGGTAGCAGCTTCAGG + Intronic
1073126271 10:101152083-101152105 GCATCCCGGGAGGCTGAGGCAGG - Intergenic
1073253235 10:102134450-102134472 CCACCCAGGGTAGAAGGGGCAGG + Intronic
1074618620 10:115093983-115094005 CCAGCCCGGGTCGCAGAGGCAGG - Exonic
1075033483 10:119042904-119042926 GCACTCTGGGAAGCAGAGGCAGG + Intronic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076136311 10:128047412-128047434 GCAGCCAGGCCAGCAGCGGCTGG - Exonic
1077627682 11:3787745-3787767 GCACTCCGGGAAGCAGAGGCGGG + Intronic
1078089646 11:8256878-8256900 GATGCCAGGGTAGCAGAGGTTGG + Intronic
1079236676 11:18696090-18696112 GCTACCAGGGAAGCTGAGGCAGG + Intronic
1079274444 11:19021191-19021213 GCATCCACTGCAGAAGAGGCAGG - Intergenic
1081098674 11:38972901-38972923 GCATCCTGGGGGGCTGAGGCAGG - Intergenic
1081345995 11:41986997-41987019 GCATCCAGGGAAGCTATGGCAGG - Intergenic
1081632796 11:44701110-44701132 TCATCCAGGGATGCAGAGCCAGG + Intergenic
1081731632 11:45375920-45375942 GCATCCTGGGGCGCAGGGGCAGG + Intergenic
1081872334 11:46389169-46389191 GGGTCGAGGGGAGCAGAGGCAGG - Intergenic
1082996719 11:59261289-59261311 CCAGCCAGGTGAGCAGAGGCTGG - Intergenic
1083622380 11:64055594-64055616 GCAGCCAGCCCAGCAGAGGCAGG + Intronic
1083717616 11:64587156-64587178 GCTACCAGGGTTGCTGAGGCAGG - Intergenic
1083996720 11:66276628-66276650 GCAGCCAGGGCAGTAGAGGCCGG - Exonic
1085087719 11:73682549-73682571 GCAACTAGGGAAGCTGAGGCAGG + Intronic
1085098349 11:73779281-73779303 GCCTCCAGGGAACCGGAGGCTGG + Intergenic
1085228107 11:74940994-74941016 GCCTCCAGGGTGTCGGAGGCAGG - Intronic
1085245805 11:75099506-75099528 GCTACCAGGGAAGCTGAGGCAGG + Intergenic
1085287089 11:75370101-75370123 GCCTCCTAGGAAGCAGAGGCTGG - Intergenic
1085297794 11:75440802-75440824 GCATTTTGGGAAGCAGAGGCAGG - Intronic
1085438071 11:76528355-76528377 GCATCCAGGGTAGCAGAGGCTGG + Exonic
1085708973 11:78812144-78812166 GTAGCCAGGGTTGCAGATGCAGG + Exonic
1085875222 11:80399138-80399160 GCTTCCAGGGAGGCAGAGCCAGG + Intergenic
1086263737 11:84973067-84973089 GCTACCAGGGAAGCTGAGGCAGG - Intronic
1086493942 11:87383741-87383763 GCTACCAGGGTGGCTGAGGCAGG - Intergenic
1088575969 11:111271668-111271690 GCATTTTGGGAAGCAGAGGCAGG - Intronic
1088754988 11:112878304-112878326 GGACCCCGGGAAGCAGAGGCAGG + Intergenic
1089963908 11:122639568-122639590 GCACCCTGGGAGGCAGAGGCGGG + Intergenic
1090174165 11:124632974-124632996 GCAGCCTGGGTTGCAGGGGCTGG - Exonic
1090865518 11:130697575-130697597 GAATGCAGGGTAGGAGAGGAGGG - Intronic
1090908328 11:131096625-131096647 GCCTCCACAGTGGCAGAGGCAGG + Intergenic
1091935776 12:4433483-4433505 GCATCTAGGGCAGCTGAGGAAGG - Intronic
1091989296 12:4941650-4941672 GAACCTAGGGTAGAAGAGGCCGG + Intergenic
1093935130 12:24992870-24992892 GCATTTAGGGAGGCAGAGGCAGG - Intergenic
1094320460 12:29177270-29177292 GGATCCAGGATAGCAATGGCGGG + Intronic
1095581557 12:43806207-43806229 GCATCCAAGGTAACAGCGCCCGG - Exonic
1096297257 12:50394163-50394185 GCATCTTGGGAGGCAGAGGCAGG - Intronic
1096329201 12:50694562-50694584 GCCTCCAGGGTAGCTGGGACTGG - Intronic
1096513698 12:52145319-52145341 GCTTCCTGGGAAGCAGAGGAGGG + Intergenic
1096583771 12:52605805-52605827 GCATCCAGAGTTGGTGAGGCAGG - Intergenic
1097213934 12:57395096-57395118 GCATCTAGGGAGGCTGAGGCAGG + Intronic
1099445774 12:82749847-82749869 GCTACCTGGGAAGCAGAGGCAGG - Intronic
1099459631 12:82906566-82906588 GCCTCCCGAGTAGCTGAGGCAGG - Intronic
1099475216 12:83100164-83100186 GCACTTAGGGAAGCAGAGGCAGG - Intronic
1100004530 12:89878461-89878483 GCACTTAGGGAAGCAGAGGCAGG + Intergenic
1101123268 12:101605612-101605634 GCACTCAGGGAAGCAGAGGCAGG + Intronic
1101413807 12:104491578-104491600 GCTACTAGGGAAGCAGAGGCAGG - Intronic
1101911481 12:108863286-108863308 GCATGCAAGGTAACATAGGCAGG - Intronic
1102113540 12:110383490-110383512 GCACTCTGGGTGGCAGAGGCAGG + Intronic
1102492129 12:113295856-113295878 GCATCCAGGCTGGAAGGGGCAGG - Intronic
1103539824 12:121658452-121658474 GCAACCTGGGAAGCTGAGGCAGG + Intronic
1104460401 12:128951289-128951311 GCTACTAGGGTGGCAGAGGCAGG + Intronic
1104760282 12:131293994-131294016 CCATCCAGGGCTGCAGGGGCTGG - Intergenic
1105541647 13:21321351-21321373 GAGTCCAGGGCAGCAGGGGCAGG - Intergenic
1105999719 13:25710436-25710458 GAATGCTGGGTACCAGAGGCTGG - Intronic
1106308175 13:28531985-28532007 CCCGCCAGGGGAGCAGAGGCAGG - Intergenic
1109180281 13:59205815-59205837 GCATGCTGGGTAGTAGAAGCTGG - Intergenic
1111536985 13:89614691-89614713 GCATTTTGGGAAGCAGAGGCTGG - Intergenic
1112339171 13:98538334-98538356 GCTACCAGGGAAGCTGAGGCAGG - Intronic
1112395999 13:99032362-99032384 GCATCTTGGGAGGCAGAGGCAGG + Intronic
1112415556 13:99200947-99200969 GCAGCCAGGATGGCGGAGGCCGG - Intronic
1113088770 13:106595699-106595721 GCATCGAGGGTGGAGGAGGCAGG + Intergenic
1113328297 13:109304814-109304836 ACATCGATGGAAGCAGAGGCTGG - Intergenic
1115599067 14:34938327-34938349 GCTACTAGGGTAGCTGAGGCAGG - Intergenic
1115807968 14:37073661-37073683 AAGTCCAGGGTAGCAGGGGCAGG - Intronic
1115888788 14:38004139-38004161 GCTTCAAGGGCAGCAGGGGCAGG + Intronic
1117696839 14:58374282-58374304 GCATCTTGGGAGGCAGAGGCAGG + Intergenic
1118270728 14:64339787-64339809 GCAACCTGGGAAGCTGAGGCAGG - Intergenic
1119423491 14:74521948-74521970 GTAGCCAGGGTAGCAGAAGCAGG + Exonic
1119734404 14:76972587-76972609 GCTTTCAGGGAGGCAGAGGCAGG + Intergenic
1119763536 14:77172611-77172633 GCTACCAGGGAAGCTGAGGCAGG - Intronic
1120588816 14:86349899-86349921 GCATCTAGGGAGGCTGAGGCAGG + Intergenic
1121241906 14:92436965-92436987 GCATCCAGGGCATCTGAGGCAGG - Intronic
1121502599 14:94450115-94450137 GCATCCCAGATATCAGAGGCTGG - Intronic
1122268656 14:100558467-100558489 GCACCCAGGGAAGGAGATGCCGG - Intronic
1123063747 14:105606073-105606095 GCACCCAGGGTCCCAGGGGCAGG - Intergenic
1123443937 15:20308082-20308104 GCATTTTGGGTTGCAGAGGCAGG + Intergenic
1123664695 15:22599106-22599128 GCACCCAGGGAGGCCGAGGCGGG - Intergenic
1124079557 15:26478874-26478896 GCATTTAGGGAGGCAGAGGCGGG - Intergenic
1124318529 15:28693544-28693566 GCACCCAGGGAGGCCGAGGCGGG - Intergenic
1124322683 15:28726730-28726752 GCACCCAGGGAGGCGGAGGCGGG - Intronic
1124439404 15:29675459-29675481 GCACCCAGGGAGGCCGAGGCGGG + Intergenic
1124523514 15:30426864-30426886 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124523592 15:30427308-30427330 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124535075 15:30538907-30538929 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124535153 15:30539350-30539372 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124564915 15:30803891-30803913 GCACCCAGGGAGGCCGAGGCGGG + Intergenic
1124763500 15:32468247-32468269 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124763575 15:32468694-32468716 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124775051 15:32580357-32580379 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124775128 15:32580802-32580824 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124995987 15:34723306-34723328 GCTTCTCGGGTAGCTGAGGCTGG - Intergenic
1126650672 15:50918407-50918429 GCTTCCATGTTAGCATAGGCAGG + Intronic
1126719425 15:51561473-51561495 GCACCCGTGGTGGCAGAGGCAGG + Intronic
1126945501 15:53814579-53814601 GAATGAAGGGTACCAGAGGCTGG - Intergenic
1127911026 15:63416381-63416403 GCATTTTGGGAAGCAGAGGCGGG + Intergenic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1130846610 15:87753635-87753657 GAATCCAGGATAGCAGGGACAGG + Intergenic
1133178815 16:4036914-4036936 GCAAGAAGGGTAACAGAGGCTGG - Intronic
1134055342 16:11166487-11166509 GCCTCCAGAGTCGCAGTGGCTGG - Exonic
1134517657 16:14900098-14900120 GCATCAAGGGAAGCAGAGCCAGG - Intronic
1134705325 16:16298749-16298771 GCATCAAGGGAAGCAGAGCCAGG - Intergenic
1134962216 16:18413365-18413387 GCATCAAGGGAAGCAGAGCCAGG + Intergenic
1134966513 16:18495964-18495986 GCATCAAGGGAAGCAGAGCCAGG + Intronic
1135604266 16:23809539-23809561 GATTCCAGGAAAGCAGAGGCTGG - Intergenic
1135982657 16:27160427-27160449 GATTCCAGGGCAGCAGAGGGAGG - Intergenic
1136159603 16:28410422-28410444 GCATCCTGGGAGGCCGAGGCAGG - Intergenic
1136203484 16:28704872-28704894 GCATCCTGGGAGGCCGAGGCAGG + Intronic
1136288550 16:29258265-29258287 ACTTCCAGGGTAGCAGGGGAAGG + Intergenic
1137649794 16:50110086-50110108 GCACCTTGGGAAGCAGAGGCAGG - Intergenic
1137763734 16:50961471-50961493 GCATCCACTGTACCAGAGGCAGG + Intergenic
1138224564 16:55281682-55281704 GCTTCCAGGGAGGCTGAGGCAGG - Intergenic
1138427279 16:56944153-56944175 GCTGCCAGGGTGGCTGAGGCAGG - Exonic
1139537616 16:67587675-67587697 GCACTTAGGGAAGCAGAGGCAGG + Intronic
1141202748 16:81910444-81910466 GCAGCCAGGGCCTCAGAGGCGGG - Intronic
1141426919 16:83950059-83950081 TCACCCAGGGAAGCAGAGGAGGG + Intronic
1141499728 16:84435713-84435735 GCTACCAGGGAGGCAGAGGCTGG + Intronic
1141590755 16:85067126-85067148 GCCTCCAGGGGAGAAGAGGTGGG - Exonic
1141965516 16:87440000-87440022 GCAGCCTGGGTAACATAGGCAGG - Intronic
1142016641 16:87752158-87752180 GCTCTCAGGGAAGCAGAGGCAGG + Intronic
1142489777 17:270601-270623 GCACTTAGGGCAGCAGAGGCAGG + Intronic
1142550891 17:738682-738704 GCTTCCTGGGAAGCAGAGGCAGG - Intronic
1144186715 17:12803351-12803373 GCATTTAGGGAGGCAGAGGCAGG - Intronic
1144838860 17:18173342-18173364 GCACTTAGGGAAGCAGAGGCAGG + Intronic
1145242810 17:21249543-21249565 GCATCCAGGGGTGCTGAGGGAGG + Intronic
1146312323 17:31778928-31778950 GCAGCCAGGGTAAGAGAAGCTGG - Intergenic
1146639248 17:34527621-34527643 GCTTACAGGGTAGTGGAGGCGGG + Intergenic
1147313144 17:39606717-39606739 GCATCCAGGGTAGCCTAGGCAGG - Intronic
1147811544 17:43173529-43173551 GCATTTTGGGAAGCAGAGGCAGG - Intronic
1148035062 17:44654255-44654277 GCATTTAGGGAAGCAAAGGCAGG - Intergenic
1148238772 17:45986345-45986367 GCCTCCAGAATAGGAGAGGCTGG - Intronic
1148431033 17:47643767-47643789 GCATCTTGGGAGGCAGAGGCAGG + Intergenic
1148460520 17:47836859-47836881 GCACCCCAGGTAGCAGGGGCAGG - Exonic
1148997059 17:51719853-51719875 GCAGCCTGGGTGGCAGAGCCAGG + Intronic
1149154104 17:53605861-53605883 GCACCCTGGGAAGCTGAGGCAGG + Intergenic
1149666368 17:58367526-58367548 GCCTCCATGGTAAGAGAGGCAGG + Intronic
1150360091 17:64524555-64524577 GCAATCTGGGAAGCAGAGGCAGG - Intronic
1151309957 17:73286896-73286918 GCATCCTGGCTTGCAGGGGCAGG - Intronic
1151524641 17:74656230-74656252 GCATTTAGGGAGGCAGAGGCAGG + Intergenic
1151617773 17:75225517-75225539 GCATCCAGTGCAGCAGTGGCAGG + Intronic
1152196771 17:78923255-78923277 GGATCCAGGATGGCAGAGGGTGG - Intronic
1153501526 18:5754961-5754983 GCTACCAGGGTGGCTGAGGCAGG - Intergenic
1155543644 18:26891455-26891477 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
1155646288 18:28082158-28082180 CCATTCTGGGAAGCAGAGGCAGG + Intronic
1159040207 18:63318082-63318104 GGATCCAGGATAACGGAGGCTGG - Exonic
1159685597 18:71415309-71415331 GCATCTTGGGAGGCAGAGGCAGG - Intergenic
1160514308 18:79470056-79470078 CCAGCCGGGGTTGCAGAGGCAGG - Intronic
1160887215 19:1355459-1355481 GAATCCAGGGAAGCAGATGGGGG - Intronic
1161302137 19:3547877-3547899 GCTTCCAGAGCAGCAGGGGCTGG + Exonic
1161656784 19:5521159-5521181 GGGTGGAGGGTAGCAGAGGCTGG + Intergenic
1162095756 19:8308972-8308994 GCATTTTGGGAAGCAGAGGCGGG + Intronic
1162297146 19:9821258-9821280 GCATTCTGGGAAGCTGAGGCAGG - Intronic
1162335091 19:10055343-10055365 GCTTCCAGGGTGGCAGTGGCAGG - Intergenic
1163401601 19:17096934-17096956 GCATTTTGGGAAGCAGAGGCGGG - Intronic
1163930625 19:20387438-20387460 GCACTCAGGGAGGCAGAGGCAGG - Intergenic
1165187309 19:34033122-34033144 GCCTCCAGGAGTGCAGAGGCAGG + Intergenic
1165220997 19:34316766-34316788 GCATCCTGGGTAGGAGAGGGAGG + Intronic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1165362664 19:35346335-35346357 GCATCCGTGGTGGCAGAGGTTGG + Intronic
1166503883 19:43359664-43359686 GCAACAAGGGAAACAGAGGCAGG - Intronic
1166506571 19:43375094-43375116 GCAACAAGGGAAACAGAGGCAGG + Intergenic
1167008989 19:46794177-46794199 GCAACCTGGGAAGCTGAGGCAGG + Intergenic
1167197875 19:48043252-48043274 GCATCTTGGGAGGCAGAGGCGGG - Intronic
926193867 2:10749016-10749038 GCTACCAGGGAAGCTGAGGCAGG + Intronic
927133750 2:20081761-20081783 GCTACCAGGGTGGCTGAGGCAGG + Intergenic
929034458 2:37677523-37677545 GCATGCAGGGAAGCAGAAGTTGG - Intronic
929093038 2:38238755-38238777 GCATCCTGAGTAGCTGGGGCTGG - Intergenic
930005893 2:46896306-46896328 GCATCCATGGCAGCAGAGTGGGG - Intergenic
930072478 2:47378411-47378433 GCTACCAGGGAAGCTGAGGCAGG - Intronic
930138937 2:47932126-47932148 GCATTCTGGGTGGCTGAGGCAGG - Intergenic
930410603 2:51021330-51021352 GCAACCAGTGTAGCTGAGGAAGG + Intronic
932998245 2:76883928-76883950 GCTTCCAGGGAGGCTGAGGCAGG - Intronic
933770202 2:85738927-85738949 GCTTCCACAGTTGCAGAGGCAGG + Intergenic
935209969 2:100931112-100931134 GCAGCATGGGAAGCAGAGGCAGG - Intronic
938124945 2:128664689-128664711 GCATCTGGGGTAGCAGTGGGAGG + Intergenic
940072829 2:149708746-149708768 GCCTCCAGGGTAAGAGAGACAGG - Intergenic
943671843 2:190671138-190671160 GCATCCAGAGAAACAGTGGCAGG - Intronic
944120465 2:196235207-196235229 GCTTCTAGGGTGGCTGAGGCAGG - Intronic
944719647 2:202410229-202410251 GCATCTTGGGAAGCCGAGGCGGG - Intronic
945226159 2:207532559-207532581 GCTACTAGGGTAGCTGAGGCAGG + Intronic
945255231 2:207797623-207797645 GCCTCCCGAGTAGCTGAGGCTGG - Intergenic
945290525 2:208122614-208122636 GCACCCTGGGAAGCCGAGGCAGG + Intronic
945594338 2:211773174-211773196 GAGTCCTTGGTAGCAGAGGCTGG + Intronic
946795433 2:223345985-223346007 GCTTCCAGGGTCACAGAAGCAGG - Intergenic
946906406 2:224420994-224421016 GAATACAGTGTAGCTGAGGCAGG + Intergenic
947184441 2:227442484-227442506 GCACCTTGGGAAGCAGAGGCAGG - Intergenic
947492913 2:230611257-230611279 GTGTCCAGGGCAGCAGAGGGTGG - Intergenic
948005000 2:234601006-234601028 GCATGCAGAGAAGCAGAGGCAGG + Intergenic
948665813 2:239534188-239534210 GCAGCCTGGGGAGCAGAGGAGGG + Intergenic
948860195 2:240749224-240749246 GCAGCCAGGATAGCAGAGCCGGG + Intronic
948913676 2:241019205-241019227 GCAGGCAGGGAGGCAGAGGCTGG + Intronic
948957359 2:241304056-241304078 GCATTCTGGGAAGCTGAGGCAGG - Intronic
948996566 2:241583157-241583179 ACATCCAGGGTAGCAACCGCAGG - Intergenic
1172283956 20:33728018-33728040 GCATTTAGGGAGGCAGAGGCTGG - Intergenic
1172535033 20:35666110-35666132 GCTACCAGGGTGGCTGAGGCAGG + Intronic
1172807138 20:37620331-37620353 GAACACAGGCTAGCAGAGGCTGG - Intergenic
1174059401 20:47821833-47821855 GAAGCCAGAGCAGCAGAGGCTGG + Intergenic
1174125654 20:48303254-48303276 GCATCTGGGGAAGCAGAGACTGG - Intergenic
1174272815 20:49381786-49381808 GGAACCCGGGGAGCAGAGGCAGG + Intronic
1174607260 20:51769738-51769760 GCTACCCGGGTAGCTGAGGCAGG - Intergenic
1175766507 20:61596282-61596304 GCATCTTGGGTAGGAGAGGGTGG + Intronic
1176104517 20:63379650-63379672 GGGGCCAGGGCAGCAGAGGCTGG - Intergenic
1178048470 21:28722633-28722655 GCACTCTGGGAAGCAGAGGCAGG + Intergenic
1178361050 21:31948716-31948738 TCATCCAGGGAAACAGAAGCTGG + Intronic
1178373803 21:32050039-32050061 GCAGCCAGGCTGGCACAGGCTGG + Intergenic
1178853837 21:36234650-36234672 GCTACCAGGGAAGCTGAGGCAGG - Intronic
1179547027 21:42119316-42119338 TCATACAGGGTACGAGAGGCTGG + Exonic
1179809538 21:43861654-43861676 GCACACAGGGCAGCAGAGGCAGG - Intergenic
1179926849 21:44539431-44539453 GCATACAGGGCGGCAGAGGAGGG + Exonic
1179934111 21:44591549-44591571 GCACACAGGGTGGCAGAGGAGGG + Exonic
1179940774 21:44637989-44638011 GCACACAGGGTGGCAGAGGAGGG - Exonic
1179949646 21:44702617-44702639 GCACACAGGGTGGCAGAGGAGGG - Intronic
1180134636 21:45854427-45854449 GGATCCTGGGTGCCAGAGGCTGG - Intronic
1180925060 22:19548042-19548064 GCATTCAGGGAAGCAGAGGCAGG - Intergenic
1181270983 22:21658241-21658263 GCAACAAGAGTAGGAGAGGCAGG - Intronic
1182270698 22:29151469-29151491 TCATCCAGGGTCCCAGTGGCTGG - Intronic
1183384859 22:37509007-37509029 CCATCCAGGGCAGCAGACGGAGG + Intronic
1184088725 22:42281509-42281531 GCATCCAAGGTGTAAGAGGCGGG - Intronic
1184134256 22:42537163-42537185 TCATCAAAGGTAGCAGAGGAGGG + Intergenic
1184352090 22:43951195-43951217 GCAACCAGGGAGGCTGAGGCAGG + Intronic
1184709973 22:46244142-46244164 GCTTCCAGGGTAGCAGCTGGTGG - Exonic
1185384509 22:50525701-50525723 GGATCCAGGGCTGCGGAGGCGGG - Intronic
949670329 3:6392562-6392584 GCATCTAGGAGAGCAGTGGCTGG - Intergenic
949926550 3:9046713-9046735 GAATCCAGGGCCTCAGAGGCTGG - Intronic
951044980 3:18028082-18028104 GCCTCCTGGGTATCAGAAGCTGG + Intronic
952717449 3:36494424-36494446 GCATCCAGGCTGGAAAAGGCAGG - Intronic
952985944 3:38783303-38783325 GCCTCCAGGGCAGAAGAGGGAGG - Intronic
954253977 3:49390834-49390856 GCATTCTGGGAAGCTGAGGCGGG + Intronic
954388402 3:50256363-50256385 GCCTCTGGGGTAGCAGAGGCAGG + Intronic
955442048 3:58966769-58966791 GCATCCTGGGAGGCTGAGGCAGG - Intronic
957041738 3:75341168-75341190 CCATCCAGGTTCCCAGAGGCTGG - Intergenic
959075775 3:101747666-101747688 GCTACTAGGGTGGCAGAGGCAGG - Intronic
959090536 3:101897973-101897995 GCATCTTGGGTGGCTGAGGCAGG + Intergenic
961046451 3:123711961-123711983 CCATCCAGGTTCCCAGAGGCTGG - Intronic
961091275 3:124114639-124114661 GCAGCCAGAGCAGCAGAGGAAGG + Intronic
961264645 3:125631969-125631991 GCATTCTGGGAAGCTGAGGCAGG + Intergenic
961946148 3:130691013-130691035 GCTGCCAGGGTAGCTGAGGTGGG - Intronic
962222991 3:133579837-133579859 GCATCTTGGGAGGCAGAGGCGGG - Intronic
962397707 3:135031428-135031450 GCATCCAGCGTAGCTGTGACTGG + Intronic
962566645 3:136667299-136667321 GCATTCTGGGTGGCAGAGGCAGG + Intronic
962918839 3:139933769-139933791 GCTGCCAGGGCAGCAGAGGGAGG + Intergenic
964409585 3:156383885-156383907 GCATCCAGGTTTCCAGACGCTGG + Intronic
964544183 3:157815265-157815287 GCATCCAGGGTTGAAGAACCTGG + Intergenic
965367554 3:167819258-167819280 GCACTCAGGGAAGCTGAGGCAGG - Intronic
966014690 3:175127281-175127303 TCATCCAAGGTACCACAGGCTGG - Intronic
966846099 3:184130992-184131014 GCTTCTAGGGAAGCTGAGGCAGG + Intergenic
967267346 3:187702264-187702286 GGTTCCAGGGTAACAGAGGAGGG - Exonic
967951547 3:194844997-194845019 GCCTCCAGATTAGCAGAGGCTGG - Intergenic
968895064 4:3395079-3395101 GCTACTAGGGTAGCTGAGGCAGG + Intronic
969222986 4:5773506-5773528 GAACTCAGTGTAGCAGAGGCAGG + Intronic
969556379 4:7914164-7914186 GCTACCAGGGAAGCTGAGGCAGG - Intronic
970301026 4:14681423-14681445 CCAGCCAGGGTGGCAGATGCTGG - Intergenic
970714406 4:18904907-18904929 GCAGCCATGGAACCAGAGGCTGG - Intergenic
971026272 4:22591344-22591366 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
971196540 4:24475620-24475642 GCATCCAGGGATAAAGAGGCAGG + Intergenic
971267442 4:25107857-25107879 GCAGCCAGGACAGCAGAGGCGGG - Intergenic
972032994 4:34486085-34486107 GCACCTTGGGAAGCAGAGGCAGG - Intergenic
972067509 4:34968294-34968316 GCATCCAGGAATGAAGAGGCCGG + Intergenic
972845459 4:42983945-42983967 GCTACCAGGGAAGCTGAGGCAGG - Intronic
972988139 4:44790847-44790869 GCATCGTGGTTACCAGAGGCTGG - Intergenic
973055345 4:45650815-45650837 GCACTCAGGGCGGCAGAGGCAGG + Intergenic
973866810 4:55123015-55123037 GCACTTAGGGAAGCAGAGGCAGG - Intronic
976976478 4:91170918-91170940 GCATCCAAGGGTGCTGAGGCTGG - Intronic
977517848 4:98044781-98044803 GCATGAAAGGTAGCAGAAGCTGG + Intronic
978470644 4:109063593-109063615 GCACCTTGGGAAGCAGAGGCAGG + Intronic
979754027 4:124317366-124317388 GCATTCAGGGAGGCAAAGGCAGG - Intergenic
982210003 4:153026770-153026792 AAACCCAGGCTAGCAGAGGCAGG + Intergenic
982410690 4:155073059-155073081 ACATCCTGGGAAGCAAAGGCTGG + Intergenic
984208947 4:176822110-176822132 GCTACCCGGGAAGCAGAGGCAGG + Intergenic
984664387 4:182409942-182409964 GCCTCCAGAGTAGCTGAGACTGG + Intronic
985313465 4:188629960-188629982 GCTTCTAGGGTGGCTGAGGCAGG - Intergenic
985541876 5:491199-491221 GCATCCCCGGCAGCAGCGGCGGG + Intronic
986588757 5:9346603-9346625 GCATACAGGTGAGCAGATGCAGG - Intronic
986759719 5:10868835-10868857 GAATCCAGGGGAGTAAAGGCAGG - Intergenic
988012559 5:25508348-25508370 GCAGCCAGGGTTGCAGATGTTGG + Intergenic
989479253 5:41910276-41910298 GCATGCAGGGTCTCAGAGGGAGG - Intronic
990425347 5:55682661-55682683 GCCTCCAGGGAGGCTGAGGCAGG + Intronic
991085787 5:62647270-62647292 GCATCTTGGTGAGCAGAGGCAGG - Intergenic
992793742 5:80237176-80237198 GCATCCTTGGTAGTAAAGGCAGG + Intronic
993115087 5:83710702-83710724 GCATTTTGGGAAGCAGAGGCGGG + Intronic
994473637 5:100240079-100240101 GCACCCTGGGAGGCAGAGGCAGG - Intergenic
994700401 5:103125877-103125899 GCATTTAGGGAAGCTGAGGCAGG - Intronic
995523316 5:113031249-113031271 CCTTCCAGCTTAGCAGAGGCGGG - Intronic
995760122 5:115553701-115553723 CCCTCCAGGTTAGCAGAAGCTGG - Intergenic
996741446 5:126802936-126802958 GCATCTTGGGAAGCTGAGGCTGG + Intronic
997408716 5:133673403-133673425 ACAGCCAGGATAGCAGAGCCAGG - Intergenic
998483698 5:142483866-142483888 GAATCCAGGCTAGAAGAGGTGGG - Intergenic
998631444 5:143903338-143903360 TCATCCAGGGTTGAAGAGCCTGG - Intergenic
1000752598 5:165115111-165115133 GCACCTAGGGAAGCCGAGGCGGG + Intergenic
1002308096 5:178296160-178296182 GCCTCCAGGGAAGCTCAGGCTGG + Intronic
1002417200 5:179126800-179126822 GCATCCCAGGAAGCAGAGGCTGG + Intronic
1002494519 5:179602730-179602752 GCAGACAGGATAGCAGAGGTAGG - Intronic
1003899530 6:10641316-10641338 GCACCCTGGGAAGCTGAGGCAGG - Intergenic
1005057717 6:21745674-21745696 GCAAACAGGTGAGCAGAGGCCGG - Intergenic
1005822136 6:29606986-29607008 GCTTCCAGGGTTCCAGAGTCTGG + Exonic
1006008533 6:31022401-31022423 GCATTTTGGGAAGCAGAGGCAGG - Intronic
1006192890 6:32220409-32220431 GCGTCCAGGTGGGCAGAGGCAGG + Exonic
1006727224 6:36208387-36208409 GCATTTAGGGAAGCAGAGGCAGG + Intronic
1007095322 6:39209364-39209386 GCATACAGGGCAGAAGAGGCAGG - Intronic
1007295323 6:40816708-40816730 GCATCCAGGGCACCAGAAGGAGG + Intergenic
1008615403 6:53221388-53221410 GCTACCAGGGAGGCAGAGGCAGG - Intergenic
1009518669 6:64653809-64653831 GCATTCTGGGAGGCAGAGGCGGG - Intronic
1012230371 6:96753981-96754003 GGCTCAAGGGTAGCAGAGGTCGG - Intergenic
1012446787 6:99314985-99315007 GCACCCTGGGAAGCCGAGGCAGG + Intronic
1015522370 6:134144647-134144669 GCATTTAGGGAGGCAGAGGCAGG - Intergenic
1015622189 6:135142680-135142702 GCATTTTGGGTGGCAGAGGCAGG - Intergenic
1016801792 6:148176238-148176260 GCTACCAGGGAGGCAGAGGCAGG + Intergenic
1016953949 6:149608532-149608554 CCACCCAGGGCAGCAAAGGCAGG + Intronic
1017459019 6:154631410-154631432 GCTACCAGGGAAGCTGAGGCAGG - Intergenic
1018060017 6:160082895-160082917 CCCTTCAGGGGAGCAGAGGCGGG - Intronic
1018730440 6:166646244-166646266 GCAGCCAGGGTGTCAGAAGCTGG - Intronic
1019706247 7:2498529-2498551 GTACCCAGGGTAGGGGAGGCAGG + Intergenic
1020213704 7:6173042-6173064 GCATCCGGGGGAGAGGAGGCAGG - Intronic
1020488209 7:8745662-8745684 GCAACTAGGGAGGCAGAGGCAGG - Intronic
1022129396 7:27390552-27390574 GCTACCTGGGTAGCTGAGGCGGG + Intergenic
1022307778 7:29164667-29164689 GCATCCCTGGTGGCTGAGGCAGG + Intronic
1022462865 7:30627903-30627925 GCTTTCTGGGTAGCCGAGGCAGG + Intronic
1022743297 7:33143809-33143831 GCATCTTGGGAGGCAGAGGCAGG - Intronic
1023839548 7:44088637-44088659 GAAACCAGGGCAGCAGGGGCAGG - Intergenic
1025229123 7:57188233-57188255 GCATCCACTGTAGTAGAGGCCGG + Intergenic
1025235499 7:57232150-57232172 GAAGCCAGAGCAGCAGAGGCTGG - Intergenic
1025772627 7:64527581-64527603 GCTACCAGGGCAGCTGAGGCAGG + Intronic
1026269224 7:68821932-68821954 GCTTCCATGGTAGCAGCGTCAGG - Intergenic
1026993313 7:74600181-74600203 GCATTTAGGGAAGCTGAGGCAGG + Intronic
1027109916 7:75429383-75429405 GCACTCTGGGAAGCAGAGGCAGG + Intronic
1027616070 7:80425774-80425796 GAGTCAAGGGAAGCAGAGGCAGG - Intronic
1028209185 7:88052395-88052417 GCTACCAGGGAGGCAGAGGCAGG + Intronic
1028558272 7:92145683-92145705 GCATTTAGGGAAGCTGAGGCGGG - Intronic
1029378736 7:100198839-100198861 GCACTCAGGGTAGAAGAGTCTGG - Exonic
1030106681 7:105993421-105993443 GCACTCAGGGAGGCAGAGGCAGG + Intronic
1030699431 7:112622217-112622239 GAATCCAGGGTGGCAGCAGCAGG + Intergenic
1031204182 7:118733435-118733457 GCATTCTGGGAAGCTGAGGCAGG + Intergenic
1034980940 7:155475843-155475865 GCATCCAGAGTTGTAAAGGCAGG - Intronic
1035769529 8:2135991-2136013 GCAGCCAGGGTTGCAGACGCAGG + Intronic
1036190095 8:6662346-6662368 GAATCCAGGGTAGGAAAAGCAGG - Intergenic
1036563611 8:9919202-9919224 GCATCCATGGTAGAAAAGGCAGG - Intergenic
1036616089 8:10388868-10388890 ACAACCAGGGTAGCAGTGGCAGG - Intronic
1036720427 8:11169603-11169625 GCATACAGTTTATCAGAGGCTGG + Intronic
1036749623 8:11435577-11435599 TCAGCCCGGGTAGCAGAGGGAGG - Intronic
1037817818 8:22121015-22121037 GGAGCCAGGGGACCAGAGGCTGG - Intronic
1038081281 8:24139537-24139559 GCTTCCAGGAAAGCAAAGGCTGG + Intergenic
1038291475 8:26253257-26253279 GCATTCTGGGAAGCTGAGGCGGG + Intergenic
1038407879 8:27335478-27335500 GCTACCAGGGAAGCTGAGGCAGG + Intronic
1039760941 8:40574689-40574711 GAAGACAGGGTAGCAGAGGTGGG - Intronic
1039909970 8:41818728-41818750 GCATTTAGGGAGGCAGAGGCAGG - Intronic
1040625279 8:49140641-49140663 GCTACCAGGGAAGCTGAGGCAGG + Intergenic
1041049041 8:53915305-53915327 GCATCCAAGGCAGCAGAGCTCGG - Intronic
1041656374 8:60354796-60354818 GCTACCTGGGTAGCTGAGGCAGG + Intergenic
1042229180 8:66539822-66539844 GCATCCAAGTTACCAGGGGCTGG + Intergenic
1045627154 8:104067500-104067522 GCATCCTGGGAGGCTGAGGCTGG - Intronic
1045736396 8:105300855-105300877 GCATCCTGGGAGGCCGAGGCAGG + Intronic
1046223427 8:111245086-111245108 GCATGCGTGGTAGCAGAGGGTGG + Intergenic
1046560219 8:115827090-115827112 GCACCCTGGGTGGCTGAGGCTGG - Intergenic
1048330959 8:133470620-133470642 GCTTCCCTGGAAGCAGAGGCTGG + Intronic
1049158377 8:141081438-141081460 GCACCTAGGGAGGCAGAGGCAGG - Intergenic
1049547175 8:143238279-143238301 TTATCCAGGGTGGCACAGGCTGG - Intergenic
1049761233 8:144332821-144332843 CGATCCAGGGGCGCAGAGGCGGG + Exonic
1050809572 9:9727207-9727229 GCATTCTGGGTGGCTGAGGCAGG + Intronic
1051643806 9:19248634-19248656 GCATTTAGGGAAGCTGAGGCGGG - Intronic
1052251757 9:26406920-26406942 GCAGCCATGGGAGCAGAAGCAGG - Intergenic
1052352175 9:27469212-27469234 GCATCTAGGGAGGCTGAGGCAGG - Intronic
1052464936 9:28818494-28818516 GCTGCCAGGGAAGCTGAGGCAGG - Intergenic
1053016475 9:34665162-34665184 GCACCCCGGGGAGCAGAAGCTGG - Exonic
1053379377 9:37636269-37636291 GCAGCCAGGGCAGTAGAGGCCGG + Intronic
1054747153 9:68866035-68866057 TCATCCAAGGTAGCAGCAGCAGG + Intronic
1054978244 9:71173303-71173325 GCATACATGGTAGCAGTTGCAGG - Intronic
1055253167 9:74333050-74333072 GTCTCCAGGGGAGCAGAGGCAGG + Intergenic
1055486058 9:76757713-76757735 GCATTTTGGGAAGCAGAGGCAGG + Intronic
1056217950 9:84422760-84422782 GCATCTTGGGAAGCTGAGGCAGG + Intergenic
1056855300 9:90123348-90123370 GCATCTGGGGAGGCAGAGGCAGG - Intergenic
1057332102 9:94125084-94125106 GCTTCTAGGGAAGCTGAGGCAGG + Intergenic
1059168467 9:112101113-112101135 GCACCTAGGGAAGCTGAGGCGGG + Intronic
1060401904 9:123354348-123354370 GCATCCAGAGAACCAGAGGGTGG + Intergenic
1061164096 9:128912477-128912499 GCATCCTGGAGAGCAGAGGTGGG + Intronic
1061964208 9:134004074-134004096 ACATCCAGGATGGGAGAGGCCGG + Intergenic
1187337983 X:18397294-18397316 GCACCCAGGGAGGCCGAGGCAGG + Intergenic
1187339395 X:18407797-18407819 GCTACCAGGGTGGCTGAGGCTGG + Intergenic
1187521118 X:20014961-20014983 GCATTTAGGGAGGCAGAGGCGGG - Intronic
1190019369 X:46859234-46859256 GCATCTTGGGTGGCTGAGGCAGG + Intronic
1190252394 X:48737155-48737177 GCGTTCAGGGTTGCCGAGGCAGG - Intergenic
1192917353 X:75666644-75666666 GCATCCAGGTCAGCAAAGGATGG + Intergenic
1193113847 X:77756636-77756658 CCATGGAGGGTAGCAGAAGCAGG - Intronic
1193980526 X:88176423-88176445 ACATGCATGGCAGCAGAGGCAGG - Intergenic
1194244962 X:91499917-91499939 GCTTGGAGAGTAGCAGAGGCAGG + Intergenic
1195065236 X:101233738-101233760 CCACCCAGGGTAGCACAGGCAGG + Intronic
1198347205 X:135770158-135770180 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198349111 X:135787420-135787442 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198351017 X:135804692-135804714 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198352923 X:135821957-135821979 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198354832 X:135839213-135839235 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198356743 X:135856495-135856517 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198358656 X:135873775-135873797 GCTACTAGGGCAGCAGAGGCAGG + Intergenic
1198801551 X:140452787-140452809 GGAGCAGGGGTAGCAGAGGCAGG + Intergenic
1199892608 X:152101859-152101881 GCTACTAGGGTGGCAGAGGCAGG + Intergenic
1200213586 X:154357619-154357641 GGATCCTGTGTGGCAGAGGCAGG + Exonic
1200563937 Y:4741227-4741249 GCTTGGAGAGTAGCAGAGGCAGG + Intergenic
1201433161 Y:13926369-13926391 GCTACTAGGGAAGCAGAGGCAGG + Intergenic