ID: 1085444677

View in Genome Browser
Species Human (GRCh38)
Location 11:76592410-76592432
Sequence CTGGGAAATGCTGCATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085444668_1085444677 5 Left 1085444668 11:76592382-76592404 CCCCACGAGGCTGAATCTGTGGA No data
Right 1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG No data
1085444670_1085444677 3 Left 1085444670 11:76592384-76592406 CCACGAGGCTGAATCTGTGGACC No data
Right 1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG No data
1085444669_1085444677 4 Left 1085444669 11:76592383-76592405 CCCACGAGGCTGAATCTGTGGAC No data
Right 1085444677 11:76592410-76592432 CTGGGAAATGCTGCATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085444677 Original CRISPR CTGGGAAATGCTGCATTTGT GGG Intergenic
No off target data available for this crispr