ID: 1085444794

View in Genome Browser
Species Human (GRCh38)
Location 11:76593142-76593164
Sequence CACAGGCACCTCTTTACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085444788_1085444794 1 Left 1085444788 11:76593118-76593140 CCTCTCTCAGGTACAGCCCAGGT No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444780_1085444794 28 Left 1085444780 11:76593091-76593113 CCACAGCCACCACCTGGGAATGA No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444786_1085444794 4 Left 1085444786 11:76593115-76593137 CCTCCTCTCTCAGGTACAGCCCA No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444782_1085444794 19 Left 1085444782 11:76593100-76593122 CCACCTGGGAATGACCCTCCTCT No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444781_1085444794 22 Left 1085444781 11:76593097-76593119 CCACCACCTGGGAATGACCCTCC No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444785_1085444794 5 Left 1085444785 11:76593114-76593136 CCCTCCTCTCTCAGGTACAGCCC No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444779_1085444794 29 Left 1085444779 11:76593090-76593112 CCCACAGCCACCACCTGGGAATG No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data
1085444783_1085444794 16 Left 1085444783 11:76593103-76593125 CCTGGGAATGACCCTCCTCTCTC No data
Right 1085444794 11:76593142-76593164 CACAGGCACCTCTTTACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085444794 Original CRISPR CACAGGCACCTCTTTACCTT GGG Intergenic
No off target data available for this crispr