ID: 1085445503

View in Genome Browser
Species Human (GRCh38)
Location 11:76598229-76598251
Sequence CATCTTGCCCTGTCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085445503_1085445505 -10 Left 1085445503 11:76598229-76598251 CCAGTCTGTGACAGGGCAAGATG No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085445503 Original CRISPR CATCTTGCCCTGTCACAGAC TGG (reversed) Intergenic
No off target data available for this crispr