ID: 1085445505

View in Genome Browser
Species Human (GRCh38)
Location 11:76598242-76598264
Sequence GGGCAAGATGAAGGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085445498_1085445505 -1 Left 1085445498 11:76598220-76598242 CCACCCACACCAGTCTGTGACAG No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data
1085445497_1085445505 6 Left 1085445497 11:76598213-76598235 CCTGGCACCACCCACACCAGTCT No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data
1085445503_1085445505 -10 Left 1085445503 11:76598229-76598251 CCAGTCTGTGACAGGGCAAGATG No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data
1085445495_1085445505 26 Left 1085445495 11:76598193-76598215 CCACGTTCTAGGTGGGCTCACCT No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data
1085445501_1085445505 -4 Left 1085445501 11:76598223-76598245 CCCACACCAGTCTGTGACAGGGC No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data
1085445502_1085445505 -5 Left 1085445502 11:76598224-76598246 CCACACCAGTCTGTGACAGGGCA No data
Right 1085445505 11:76598242-76598264 GGGCAAGATGAAGGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085445505 Original CRISPR GGGCAAGATGAAGGAGAAAG AGG Intergenic
No off target data available for this crispr