ID: 1085446195

View in Genome Browser
Species Human (GRCh38)
Location 11:76602738-76602760
Sequence TAAATCCCACACCTAGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085446195_1085446206 16 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446206 11:76602777-76602799 CCAGGAAGATCCGAGGCAAAGGG No data
1085446195_1085446201 9 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446201 11:76602770-76602792 CAGCCTCCCAGGAAGATCCGAGG No data
1085446195_1085446198 -2 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446198 11:76602759-76602781 TACACAGCCTCCAGCCTCCCAGG No data
1085446195_1085446204 15 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446204 11:76602776-76602798 CCCAGGAAGATCCGAGGCAAAGG No data
1085446195_1085446207 17 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446207 11:76602778-76602800 CAGGAAGATCCGAGGCAAAGGGG No data
1085446195_1085446209 30 Left 1085446195 11:76602738-76602760 CCTCGCCCTAGGTGTGGGATTTA No data
Right 1085446209 11:76602791-76602813 GGCAAAGGGGAAAGTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085446195 Original CRISPR TAAATCCCACACCTAGGGCG AGG (reversed) Intergenic
No off target data available for this crispr