ID: 1085448145

View in Genome Browser
Species Human (GRCh38)
Location 11:76614951-76614973
Sequence AGGCTGAGCCCGAGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448145_1085448150 15 Left 1085448145 11:76614951-76614973 CCAGCACAGCTCGGGCTCAGCCT No data
Right 1085448150 11:76614989-76615011 GCCCTTGACGCAGTCCCCTTGGG No data
1085448145_1085448149 14 Left 1085448145 11:76614951-76614973 CCAGCACAGCTCGGGCTCAGCCT No data
Right 1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448145 Original CRISPR AGGCTGAGCCCGAGCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr