ID: 1085448146

View in Genome Browser
Species Human (GRCh38)
Location 11:76614971-76614993
Sequence AGGGCTGAGGCGTGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448146_1085448149 -6 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG No data
1085448146_1085448158 24 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448158 11:76615018-76615040 CTGCACTGATGCCAGTGAGATGG No data
1085448146_1085448159 29 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448146_1085448150 -5 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448150 11:76614989-76615011 GCCCTTGACGCAGTCCCCTTGGG No data
1085448146_1085448160 30 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448160 11:76615024-76615046 TGATGCCAGTGAGATGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448146 Original CRISPR AGGGCTGAGGCGTGTCTGGA AGG (reversed) Intergenic
No off target data available for this crispr