ID: 1085448149

View in Genome Browser
Species Human (GRCh38)
Location 11:76614988-76615010
Sequence AGCCCTTGACGCAGTCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448147_1085448149 -10 Left 1085448147 11:76614975-76614997 CCAGACACGCCTCAGCCCTTGAC No data
Right 1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG No data
1085448146_1085448149 -6 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG No data
1085448145_1085448149 14 Left 1085448145 11:76614951-76614973 CCAGCACAGCTCGGGCTCAGCCT No data
Right 1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448149 Original CRISPR AGCCCTTGACGCAGTCCCCT TGG Intergenic
No off target data available for this crispr