ID: 1085448150

View in Genome Browser
Species Human (GRCh38)
Location 11:76614989-76615011
Sequence GCCCTTGACGCAGTCCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448145_1085448150 15 Left 1085448145 11:76614951-76614973 CCAGCACAGCTCGGGCTCAGCCT No data
Right 1085448150 11:76614989-76615011 GCCCTTGACGCAGTCCCCTTGGG No data
1085448147_1085448150 -9 Left 1085448147 11:76614975-76614997 CCAGACACGCCTCAGCCCTTGAC No data
Right 1085448150 11:76614989-76615011 GCCCTTGACGCAGTCCCCTTGGG No data
1085448146_1085448150 -5 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448150 11:76614989-76615011 GCCCTTGACGCAGTCCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448150 Original CRISPR GCCCTTGACGCAGTCCCCTT GGG Intergenic