ID: 1085448159

View in Genome Browser
Species Human (GRCh38)
Location 11:76615023-76615045
Sequence CTGATGCCAGTGAGATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448146_1085448159 29 Left 1085448146 11:76614971-76614993 CCTTCCAGACACGCCTCAGCCCT No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448153_1085448159 -3 Left 1085448153 11:76615003-76615025 CCCCTTGGGAGCTCCCTGCACTG No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448152_1085448159 9 Left 1085448152 11:76614991-76615013 CCTTGACGCAGTCCCCTTGGGAG No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448147_1085448159 25 Left 1085448147 11:76614975-76614997 CCAGACACGCCTCAGCCCTTGAC No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448154_1085448159 -4 Left 1085448154 11:76615004-76615026 CCCTTGGGAGCTCCCTGCACTGA No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448151_1085448159 10 Left 1085448151 11:76614990-76615012 CCCTTGACGCAGTCCCCTTGGGA No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448148_1085448159 16 Left 1085448148 11:76614984-76615006 CCTCAGCCCTTGACGCAGTCCCC No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data
1085448155_1085448159 -5 Left 1085448155 11:76615005-76615027 CCTTGGGAGCTCCCTGCACTGAT No data
Right 1085448159 11:76615023-76615045 CTGATGCCAGTGAGATGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448159 Original CRISPR CTGATGCCAGTGAGATGGCC AGG Intergenic