ID: 1085448402

View in Genome Browser
Species Human (GRCh38)
Location 11:76616200-76616222
Sequence TTGAACAAGCATGTGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085448402_1085448412 30 Left 1085448402 11:76616200-76616222 CCCTCTGCCACATGCTTGTTCAA No data
Right 1085448412 11:76616253-76616275 TGGGCCCAGCCACTGCCTCCAGG No data
1085448402_1085448407 10 Left 1085448402 11:76616200-76616222 CCCTCTGCCACATGCTTGTTCAA No data
Right 1085448407 11:76616233-76616255 GACTGCCTTCTCCAGCCTTCTGG No data
1085448402_1085448408 11 Left 1085448402 11:76616200-76616222 CCCTCTGCCACATGCTTGTTCAA No data
Right 1085448408 11:76616234-76616256 ACTGCCTTCTCCAGCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085448402 Original CRISPR TTGAACAAGCATGTGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr