ID: 1085449172

View in Genome Browser
Species Human (GRCh38)
Location 11:76621809-76621831
Sequence CTTCCAACAGGGCCGTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085449163_1085449172 27 Left 1085449163 11:76621759-76621781 CCTGTCTCCTAGAGCCCTGGTTT No data
Right 1085449172 11:76621809-76621831 CTTCCAACAGGGCCGTGCTAAGG No data
1085449164_1085449172 20 Left 1085449164 11:76621766-76621788 CCTAGAGCCCTGGTTTCTGCATC No data
Right 1085449172 11:76621809-76621831 CTTCCAACAGGGCCGTGCTAAGG No data
1085449166_1085449172 12 Left 1085449166 11:76621774-76621796 CCTGGTTTCTGCATCTGCACAGT No data
Right 1085449172 11:76621809-76621831 CTTCCAACAGGGCCGTGCTAAGG No data
1085449165_1085449172 13 Left 1085449165 11:76621773-76621795 CCCTGGTTTCTGCATCTGCACAG No data
Right 1085449172 11:76621809-76621831 CTTCCAACAGGGCCGTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085449172 Original CRISPR CTTCCAACAGGGCCGTGCTA AGG Intergenic
No off target data available for this crispr