ID: 1085451452

View in Genome Browser
Species Human (GRCh38)
Location 11:76636515-76636537
Sequence GACAGCCATCCTCATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451452_1085451466 18 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451452_1085451457 -4 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451457 11:76636534-76636556 TGTCATCCTCCCCGGGGCTGAGG No data
1085451452_1085451458 -3 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451452_1085451465 17 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451465 11:76636555-76636577 GGGTGGCTGCCAGTGTCAATGGG No data
1085451452_1085451464 16 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451452_1085451459 0 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451459 11:76636538-76636560 ATCCTCCCCGGGGCTGAGGGTGG No data
1085451452_1085451456 -10 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451456 11:76636528-76636550 GATGGCTGTCATCCTCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451452 Original CRISPR GACAGCCATCCTCATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr