ID: 1085451455

View in Genome Browser
Species Human (GRCh38)
Location 11:76636527-76636549
Sequence GGATGGCTGTCATCCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451446_1085451455 7 Left 1085451446 11:76636497-76636519 CCTTGACTGGTTCCCCTTCCAGC No data
Right 1085451455 11:76636527-76636549 GGATGGCTGTCATCCTCCCCGGG No data
1085451449_1085451455 -6 Left 1085451449 11:76636510-76636532 CCCTTCCAGCCTCATGAGGATGG No data
Right 1085451455 11:76636527-76636549 GGATGGCTGTCATCCTCCCCGGG No data
1085451451_1085451455 -7 Left 1085451451 11:76636511-76636533 CCTTCCAGCCTCATGAGGATGGC No data
Right 1085451455 11:76636527-76636549 GGATGGCTGTCATCCTCCCCGGG No data
1085451448_1085451455 -5 Left 1085451448 11:76636509-76636531 CCCCTTCCAGCCTCATGAGGATG No data
Right 1085451455 11:76636527-76636549 GGATGGCTGTCATCCTCCCCGGG No data
1085451444_1085451455 21 Left 1085451444 11:76636483-76636505 CCATGCTCTCTGGTCCTTGACTG No data
Right 1085451455 11:76636527-76636549 GGATGGCTGTCATCCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451455 Original CRISPR GGATGGCTGTCATCCTCCCC GGG Intergenic