ID: 1085451458

View in Genome Browser
Species Human (GRCh38)
Location 11:76636535-76636557
Sequence GTCATCCTCCCCGGGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451449_1085451458 2 Left 1085451449 11:76636510-76636532 CCCTTCCAGCCTCATGAGGATGG No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451453_1085451458 -7 Left 1085451453 11:76636519-76636541 CCTCATGAGGATGGCTGTCATCC No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451444_1085451458 29 Left 1085451444 11:76636483-76636505 CCATGCTCTCTGGTCCTTGACTG No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451446_1085451458 15 Left 1085451446 11:76636497-76636519 CCTTGACTGGTTCCCCTTCCAGC No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451452_1085451458 -3 Left 1085451452 11:76636515-76636537 CCAGCCTCATGAGGATGGCTGTC No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451451_1085451458 1 Left 1085451451 11:76636511-76636533 CCTTCCAGCCTCATGAGGATGGC No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data
1085451448_1085451458 3 Left 1085451448 11:76636509-76636531 CCCCTTCCAGCCTCATGAGGATG No data
Right 1085451458 11:76636535-76636557 GTCATCCTCCCCGGGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451458 Original CRISPR GTCATCCTCCCCGGGGCTGA GGG Intergenic