ID: 1085451460

View in Genome Browser
Species Human (GRCh38)
Location 11:76636540-76636562
Sequence AGCCACCCTCAGCCCCGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451460_1085451466 -7 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451460_1085451468 10 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data
1085451460_1085451464 -9 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451464 11:76636554-76636576 AGGGTGGCTGCCAGTGTCAATGG No data
1085451460_1085451465 -8 Left 1085451460 11:76636540-76636562 CCTCCCCGGGGCTGAGGGTGGCT No data
Right 1085451465 11:76636555-76636577 GGGTGGCTGCCAGTGTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451460 Original CRISPR AGCCACCCTCAGCCCCGGGG AGG (reversed) Intergenic
No off target data available for this crispr