ID: 1085451461

View in Genome Browser
Species Human (GRCh38)
Location 11:76636543-76636565
Sequence GGCAGCCACCCTCAGCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1085451461_1085451466 -10 Left 1085451461 11:76636543-76636565 CCCCGGGGCTGAGGGTGGCTGCC No data
Right 1085451466 11:76636556-76636578 GGTGGCTGCCAGTGTCAATGGGG No data
1085451461_1085451468 7 Left 1085451461 11:76636543-76636565 CCCCGGGGCTGAGGGTGGCTGCC No data
Right 1085451468 11:76636573-76636595 ATGGGGAATCCATGCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1085451461 Original CRISPR GGCAGCCACCCTCAGCCCCG GGG (reversed) Intergenic